GenePrediction:GLEAN_4570 Details

Name: GLEAN_4570
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1882614..1879945 (- strand)
Length: 2670
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1882614..1882612 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_167:1882541..1882144 (- strand)
Length: 398
Type: CDS
Source: GLEAN
Position: GCSC_167:1882077..1882010 (- strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_167:1881767..1879945 (- strand)
Length: 1823
>GLEAN_4570 class=GenePrediction position=GCSC_167:1882614..1879945 (- strand)
ATGGTAATACAATTCCGGCCACAACTGTTCGCGGACAAGTCAAGACAAAGCTAACGAATGTCATCGACGCCAGGCCAAGA
TAACCGACGACACGCTCGCGCTGAGATTCAAGTATGGCATCCATACTGTCTTCCTCTCGGTCGACCCTCTCACGCCCTTC
TCCACCATATCAGAAGACCTGCTTGATGTATTGCGCGAGTGCTACCCAGACGGACTGACAGTGTCGGTCTTGGCGTCGGA
TCGCACGCAAGTGCCGGTAAAAGGAGAGGAATACCGAGTGTTCTACGCCCTGCCCAAGAACCCGAAAGACTTGTCGTATG
GTTGGAAGCCTTTGAATATTAACGGCAGCCAAACACCGGCCAGCCTGAAGCTGAAGGATAATGCAGCTCTGGCGTTCCAG
ATCCAGACGAGCGAGATGATGGAGGAAGAGCCATTTTTTGAAGTTGCGATCCCGACGCAGGACGAAGAGGAGTGAGGGGG
CAAGAAGGTGTCTCAAAGTGTCTCGCGAGTACTCCGTATTACTCCGTACTTCTTCAGTGCTCAAGCTGGCACGGAAACCG
TCGTCGTCCTCTGCCTTCCTCTGGAAAAGTGGGTCTGTCACTTCAGTTAGTGTAGACGCGTTTAATTTCATAGAGGGACA
CCCACCTACAATTAAATGTTAGGGTCATCAAAAAGGAGAACACAACCCCCAGTCGGCCATAAAGAGCGAGAGGAAAAGGG
GGGCAGTGACAAAGGCCACAGCAGCGGTTGTTCTTTTTAATTTTTGCTCGTCTCTTGATTCCAGTTCAGCCGCACACGCG
TCGTCGGGCATTGTCGTTCTTCCCAGCATAGCAGACGCCCCATGCAGCTCATCTTCACATGTCCGGCTCGACCACGTTGG
CTCGGCTTCGGCTGGCGTTGCTCCTGCTGCTGCCCCTGTCGGCCGTGCTGACGACATACCTGTACCTGTACCCGGTGATC
GGCGGCTGTGCGTTTCCGCTGCCGCAAAACGACAGTGACAGTGGCAATGGCAGCAGAGATGGAGCCGACCAGGCGGCCTT
TCTCTCGACCGCGAGACAGCACCTGCCGGCAGCACCGACAGCAGCCGGCAGGTTGGCACCGTTCCGGCTGCTGGCGCTGG
GCGACCCGCAGCTAGAGGGCGACACATCGATCCCCAACGCACACGGCGACTCGTTCCCACACCTGGTCCGAGCGATGGAG
CATGCGATGTTTCGCAGCAGCGGCCTGAGCCTGCGGGGACGGATACAGCAGACGCTGCACGACCTGGTGGATTTTTGGTT
CGAGGACGTGCCCAACACAGCGTGTTCGGTGCGCAAGCGCATCGACCTGGTGGGCAACGACTTTTATCTCGCACACATCT
ACCGCACGATGCGCTGGTGGGCCAGGCCGACACATGTGGCTGTGCTGGGCGACCTGCTGGGCAGCCAGTGGGTGGCGGAC
GACGAGTTTGAGAAGCGCGCCCACCGCTACTGGCATCGTGTCGTGCGGGGTGGCCGCCGTGTGTCCGACAGCCTGGCACT
TTACCCGGCCGACGAGTACGCCCTGTCGGGCTACTTGGGGGGGTTCGTGAGCAAAAACGAGACGAGCGAGACGAACGGGA
CGAACGGGACGAACGAGTCCGAGACGGACGATTGGTCGGATCGGATCATCAACGTGGCGGGCAACCACGATATTGGTTAT
GCGGGCGACATCACGGAGGAGCGATTGGGCCGATTCGAGCGGGCTTTTGGCAAGGCCAACTACGAGCTTCGGTTCGAGCT
GCCGCTGGCAGCCCTGAGCGGGAATGCAAGCGAGCACGACCTGTTCGACCGCGAGACGAATCCATGGTCGAACCGGCTGG
TGCCCGAGCTGCGTATCGTCAACCTTAACGACATGAACCTCGACACGCCGGCGCTCAGCGCCGCCATTCAGGACCAGACG
TACGGCTTCATCAACGCGGTGATCAACACGGCGTCGGCCGTCGAGTTCCGTGGCCACTTCACCGTCGTGCTGACCCACGT
ACCGCTGTACAAGCCGGCCGGCACCTGCGTGGACGAGCCATACTTTGCCTTTGGCCCCGACGATGATGGCGGCCTGCTGG
CCGAGCAGAACCAGCTCAGTGCCGATGCCAGCCGCGGCTTTCTCGAGGGCATTTTCGGTATGCACGGCGATCCCGGTGCT
CCGGCCGGTGGTCGTGGCCGTGTCGGCGTCATCCTCAACGGCCACGACCACGAGGGCTGCGACACGTTCCACTACGTCAA
CCAGTCGCAAGGGCCCGTCTGGGAAGCCGTCCGCTGGGACGCGGCCACCAACAAGACGATTGTCGGCCGTGCTGGCTTCC
CCGGCGTGCGCGAAATCACCGTGCGCAGCATGATGGGCGACTATGGCGGCAATGCCGGCCTGCTGAGCGCCTGGTTCGAC
GAGGCCGCCTGGGAGTGGCGCTTCGACTTTGCCACCTGCGCTCTCGGCCGCCAGCACCTCTGGTGGGTCGTCCACGTGCT
CGATGTCCTCGTCCTCGCCGCCGTCCTCGTCTACGGCCTCGCCCGGCTCGTCGAGACGGCCATCCTGCAGACACCGGCCG
ACTTTGCCAACACCAGCAGCACACCCACCGCCAAGATGACGGTGTCATCTGCGAAGAAGTTCGTGGCGGCCGGGACCGCA
AAGCAACGTCCGTCCAAGGCGGCTACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62