GenePrediction:GLEAN_4574 Details

Name: GLEAN_4574
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1869336..1867694 (- strand)
Length: 1643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1869336..1869087 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_167:1869033..1868745 (- strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_167:1868690..1867694 (- strand)
Length: 997
>GLEAN_4574 class=GenePrediction position=GCSC_167:1869336..1867694 (- strand)
ATGGCCAGTCTAGACCCGATCAAGGTCCCATTCGACTCGGATCTCGAGCGGACCGACACCACGGTCAAAAATGGTGCCGT
CATTAGCACGGGATCCGATAGCGAAGCCCCGGATGCCGTCGACGACGAGCACACGCCACACGTGCTTGACCACAAGGCCG
AGCGCGCCCTCGTGCGGAAGTTCGACATGCGATTGCTGCCCATCCTGGCCGTCATGTACCTCTTCAATGCGCTCGACAAG
TCCAATCTAGGTGCGCCCATTGTCTCACGGCCAATGCTTCATCCACATTCTGACAGATCACAGGTAATGCCAAGACAGCT
GGTCTCGAAAAGTCGCTCGGCTTGGTCGGCAACCAGTACAACATTCTTCTCAGCGTCTTCTTCGTGCCCTACGTGCTGAC
CGCGCCCTTTCTCGGCATTCTGGGCAAGCGGTTTGGCCCCAGCCGTGTGCTGCCAATCATGATGTTCTCCTTTGGCTCCT
TCACCCTGTTGACCACTGCCGCCTCCAACTATGCCGGCATCATGACGCTGCGCTGGTTCTTGGGCATGAGCGAGTCGGCC
TTTTTCCCGCTGGTCATCTACTACCAGACAATGTACGTAATCTATCTTATTGGTTGCTGCTTCGCTCTTGACTTACCAAA
CCCTAGGTTCTACCGCCGTGGCGAGCTTGCCCGCCGTCTGGCCATCTTTTACGCCGCTTCCAACATCGCGTCGGCCTTTA
GCGGCCTTCTGGCGTTTGGCGTCTTCCATATCAAGTCGGGTCACATGGCCAACTGGCGGTACCTGTTCGTTATCGAAGGC
TCGGCTACGGTGGTCTTCTCCGTCTTTGCCTTTTTCTACCTGCCGGCCTCGGCGGCTGAGGCGACATTCCTGGACGAGAA
GGAGAAGCAGCTGGCCTACCACCGCATGGCCGTCGACAGTTCCGGCATTGTCAACGAGCCGTTTGTGTGGCGTGAGGCCT
TTCGCATCTTCCGCGAGCCCACCAGCTGGGCCATCCTGGGCATTGAGATCTGCCTCGGCGTACCGCTGCAGAGCGTCAGT
CTGTTCCTGCCGCAGATCATCGCCCGCCTCAAGTACTCCACCGTCAAGACGAATCTCTACACAGTTGCGCCCAACGTATC
GGGTGCCGCCATGCTTCTCATCCTGGCCTTTGCCAGCGACTACACCCGCCTGCGTTTCCCCTTTGTTGTCGCCGGCTTCC
TTTTCACCTTCATTGGCTTCGTCATCTACGCCGCCATCGACGTCGAGACTGACCTGCATGTTGCTTACTTTGCCTGCTTC
ATGATGACCTGGGGCACCAGCGCCCCCAGCGTGCTGCTGGACGTGCTCTACAACAACAACATTGTGCACGAGGGCCGCCG
CGTTGTCCTGACCAGCTTTGGCGTTCCTGTCGCGAACGTCATGGGCCTCGTCAGCTCCAACATCTTCCGGAAGCAAGACG
CACCCCGCTATCTGCCCGCGCTGGCAACGACTGCTGCCTTTGGTGGAACCGGCGCCGTGCTGACCTTCCTGCTCGGCATG
TACATGATTTTTGACAACAAGCGGCGCGATCGCAAACAGGGTTTCAAGGTAAAGGCCAAGGACATCCCAACGGAGAAGCT
CTACAACGGTCCTTCGTCGCCGGACTTCCGCTGGTTCCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62