GenePrediction:GLEAN_4576 Details

Name: GLEAN_4576
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1862221..1860750 (- strand)
Length: 1472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1862221..1861869 (- strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_167:1861803..1861415 (- strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_167:1861351..1860750 (- strand)
Length: 602
>GLEAN_4576 class=GenePrediction position=GCSC_167:1862221..1860750 (- strand)
ATGCGTGGAATCCGGCCCATCCGAACAGGCCCATTCCGTGAGCGGACACGACTGCACCCACCATTGCACCCACCACGACA
TCCACCACTGCAGGCCCTTGCATGCGGTCGGCGTGCTGTTTCCCTGCTTGCTCAGACCGTCTTCCGGCCAGCTGCACAGC
GGTTACACTGGTGGCCGTTAGCGCATCGACTAAGCAAGGCTATGACACGACGGAGCAATATTCGAGCGGTGCACACAGAC
TCGGGGCCAGAGCATCTGACCGCTCCTCGAGTCATGGCCGGTACGCAGAAGGGCCGAGGATCGGCCCAGGTTCGGAATCC
GGCAGCGCCGAGCGCCGCAGCGCCGAGTGCCAGGTGTGTTGCTGAGCCGAACAGAGGCCTCGGACATGAGAGAGAAGCGC
TGACGGGCGGGCGTGCAGCATCGTGGTGATATCCCCGGCCAATGAGGTGCTGCTGCTGCGCCGCATACAAAACGGCACGT
TTGCAGCGGCCCACGTGTTCCCGGGTGGCAACCTCAGCAGCTTCCACGAGGACGGGCTGATCCCGGCCAGCGACAGTGCC
GAGCGACATGTGGACGGCCCGGCGTACCGGCTGGCAGCCATCCGCGAGACGTTTGAGGAAAGCGGCGTGTTGCTGGCACG
GCCACGGGGCACGAGCCGGGGTGACAGTGCTGGCGAGCCGGCAGCGGATGAGCGGCTGCTCTTGCAGGTGCCCGAAGACA
TAGCCGGCGCAGGACGGAAACAGGTCGAGCGCAAGGAGGTGCGGTTTGTTGACTGGCTGGCCAGCGTGGGTGGAGAGGCC
GACAGCGGTGCGTTTGCGTGTAGCACCGTATCCATCCATCCTCTTTCTCGTTGCTGACCAGTCTCTTTAGACGGGTTGAT
TCCGTTTACGCGCTGGATCACACCGCCGAACCTGGCACGTCGCTTCACGACGCAGATGTACCTTTACCTGATGCCGCTGG
CAGCGACCGCGACAGGGATGAAAGCCACGGCCGACCAGACGGAGGTGTCGGCGGCCGAGTGTGCCTCGGCGGCAACGTGG
GTGCAGCGGGCGCAGCGCAACGAGATCATCCTGTTTCCGCCGCAGATGTACATCCTGGCGCTGCTGGCACCGATTCTCGG
CAGGTCAGACGGACAGATGGCAGACCATGCCGGCGAGCGGCAACGGCTGGCCGAGCTGCTGCGCCAAGGAAGCGGACCGG
AAGCCGGCCAGGCCTGGGCCGAGCTGGTGATCAGTCCGCGCATGTTGGCACGGCTGCCCGACGGCCGCACCGCCTTGAGG
CTGGACCAGCCCGGGCCAGAGCTGAGGAACAGCGGCAGGACGGGCGACCTGCATCGCGTGATGGTGGTCGGCAGCACATC
GTCAGGCTCGCCTCGGGACGTGCAGCTGCAGTCGCGGGCAGAGGTGCTGGATGCCATACGAGCAGCTGCAGCGGCGCAGG
CGGTGAGACCGGAGGGCAAAACAAGGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62