GenePrediction:GLEAN_4577 Details

Name: GLEAN_4577
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1859687..1854212 (- strand)
Length: 5476
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1859687..1858788 (- strand)
Length: 900
Type: CDS
Source: GLEAN
Position: GCSC_167:1858697..1858335 (- strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_167:1858277..1856981 (- strand)
Length: 1297
Type: CDS
Source: GLEAN
Position: GCSC_167:1856686..1856477 (- strand)
Length: 210
Type: CDS
Source: GLEAN
Position: GCSC_167:1856202..1856168 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_167:1855711..1854212 (- strand)
Length: 1500
>GLEAN_4577 class=GenePrediction position=GCSC_167:1859687..1854212 (- strand)
ATGGCGGGAGGCAATTCATTTGCAAACCACACGCCACCTCTGGCCTTCACCCCCGATGCTGAGTCGTCTCCGTCAAACGC
CCCGTCTCAGCATGAATTCGTCCAGATCGCTCCCTCCACCACCAGCCTGACCAGCCTGGCTAGTCTGGCCAGCAGCACCA
CCACCCATGGACCGAGCCTCATCAACTCTCCGAGCGTGCTCAGCCAGAATGGCTTCAGCCAGTCCGGTATCGGCCAGCCA
CTGCCTCAGATCCCTGGCGCCACCGTCTACACGCCCACAGCCATTCCTGGCATCGAGCTGAATCCGCGCAGCTGCGTTAC
TTGTCGTCGCCGCAAGGTCCGTTGTGACAAGCACATGCCCTGCTCCAACTGTCGCCGCGCCTTGATTCCGTGCATATTTC
CCGCACCCGAACGTGCGCCGCGCCGGCCGCGCCGCAAAGACCCCAGCGCTCTGCGCCCACACCAGTCGACTGAGCGCGAG
ATCGAGTTGCTTAAGCGCTTGCGCAAGTTGGAAGGCATTGTCGAGGAGCTCAGCGGACAGGTTGAGCTGGAGGCCACGAA
GCAGCACTCGAGCAACGGCGGCTCGCCCGAGGCCATCAACGGAACCCAAGGCAGCATCGTCGGAGGCATGAACGGCAGCA
GCTGTGCCGACGGCTCCGTCAACGGCAACGGCATCGCAAATGGTGGTCATGGCCTTGCCAACGGCGCCGGAAGAGGACAG
CAGTCGCCCATGATGACGAATATGCCCGCCGTCGGAAGTCCTGGACGACTGATCAGCGACAGTAACGGAAAGATGAAGCC
TGGAAAGGACGGCGAGCGACAGTTTGGCCGCCTCGTCATCAACGATCATGGGCGCTCGCGCTATGTCAGCAGCGCTTTTT
GGAGCAAGATCAGCGACGAGGTATGTATCGTGATAATCTCGATCACACCCCCTCTCCTCTTGTCTGTCTTGATTCTGCTT
GTGTTGCGGATGACTGACAACGGTAACTAGCTGGACGAGTTGCGGTCAGAAGCCCAGCGGATTTCCGAGCCAGAGACTGA
AGCTTCCGAGACTGAGAGCTCGCCGCCTCACGACACCGACGAACGACCAGAAGCAGACCACCACGCCTTTTGTTTCGGCT
TTCAGTCTACTACGGTCGACCTGCGACCGCTGCATCCGCTGCCGTCCCAAATTCCATATATCTGGCAGGTGTATCTGGAA
AACGTCGATCCCGTGGTCAAGGTGCTGCACACCGTCTCGACCAGCAAGCTCATAAGGAATGCACGCACAAACTTGGATGA
CATCTCTCCTGCAGCGGAGGCATTGATGTTTGCTATTTATTATGCTGCCGTTACATCTTTAGATGAAAATGAGGTGAGAT
TCGATACCCTTGCTCCCCCAAGGCTCTCCCACGCTGACTTGTGACTGCAGATTAAAATAAACTTTATGGCCGATAAGGAG
GCACTGGTGAACAAGTACCGCTTCGCCCTGGAACAGGCTCTGGCCAAGGCCCAGTTCCTCGTCTCGGCCGATTTGGTTGT
CTTGCAGGCGTTTGTGATCTACATTGTCCTTATCCGGCGCAATGACGAGACCCGACTTGCGTGGACCATGACGGGCCTCG
CTATTCGCATCAGCCACTCCATCGGACTGCACCGTGACGGCAGCAATTTCCCCAGCCTCTCGCCCTTTGAGGTCGAGATG
CGCCGGCGCCTGTTCTGGGCGATCTGCATCATCGACATGCGCTCGGCCGAGGATCTGGGAACGGATCTGTCCATTCTTGA
GCATGGCTTCGACACGCAGCTGCCACTGAACATCAACGACAGCGACATCAGCCCGGAGAGCACCACGCTTCCGCCCCCCC
GCAAGGGCGCCACGGACGTCACATTTGCACTCATCCGGTACGAGATTCTCAGCGTGGTGCGCCGGATGCATGTGATGCAG
TCGGGGGGCATCGGCTCGATCTATCCCGTAGACGCCACGGCCAGCCTGGAGGAGCGGGAACGCATGATCCACGACATCTA
CGAGCACATCCAAGAGAAGTACCTGGGCAGCAGCGAGACGGCGTCAGATCCGATTTTCTGGGTGGCCGGCATCATTGCTC
GCGTGATCTGCACGCGGATGACCCTGGCGGTGTACCAGCCGATTCTATTTCCGACAGGGAGCAACGAGGATATGTCGCGG
GAGCTGCGTGACCGACTGTTCACCGGCTCGACCGAGCTGTTTGAGTACACCACCAGCCTGACGACGGACTCGCGCACGAA
GCAGTGGCGCTGGCTGTTCAAGACGTACATGCAGTGGCACGCGGTGGCATACATCTTGATGGAAGAGTCGCGACGGCCCT
GGAGCGCGTCTGTCGAGCGGTCGTGGCAGGCGATCTCCGCGATCATGGCGGGCCCCAAGTCGCAGGAGATCGAGAAGATG
ACGGCCAACGCGTCCATCTGGCTGCCATTCAAGATGTTGTACAACAAAGCACGCAAGCACCGTGAAGCTGAGATACAGCG
GCTCCGGGCGGACCGCAGTGAAGTCATCCGGCTGGACCGTGAGGACCACGTCCGCCTTGGACCTACCATCTTCTCTGCCG
CCGAGGGCGGTATTGACGGCTTTCACTGGCGGGAACAGTGGCTCGAACTGATGGGAGCCCCTGAGCTGGCGGCCGAGTCA
CCGGCACCGCCCTCGACGGGCGAAGGGTCGGTCGCTGACAGTGTGGACGCAGCCAAGACCGAGAAGAGTGCCCAGTCGGA
TGGGCAGCGGCAATTAGAACAACGAAGGCGACAACGGCAGCAGCAGAAGCAGCAGCAACAGCAACGGCAGCAACAGCAAC
ATCAACAGCAGCAACAACAACATCAACAACAGCAGCAGCAACAACAACAGCAGCAACAACAGCAGCAACAGCAACAGCAA
TGCCAACAACAGCAGCAATTGCCCGTTAGCACAGAGGTGACGGCCAACAACATTCTGGACCGCGTGTTCGCGCAGCCGAC
ATTTGAGTCATCGGACTTATATCCGGTGTACATGGCCGAAGAACTTGCCAAGGCGCTGCCGGAAGGCAATCTGTACGGGA
CCTATGCAAATTCTGATATACCACGCCAAGATACCGCGCTCTCCCACTTTGTTGCAAATGCATCGTTTGGCGGCGGTATG
GGCAACGGAACTGGAGGAAGCAATGGGAGCAATGTTCCCACGACATCGTCGTCGCAGCAATCGACTTCTACAGCGCTCGT
TGATGGCATGGGTAAGGACTACCCGCCAGCTTGGCTGTGGACGCCCCCGGGTCCGGCATCGTCACAGCAGCTACAACATC
AGCAGCTGCAGCAACATCAGCAAATGCAGCAGCAGCAGTTCCCGGGATCGCTCGTCGACGAGGACATCACCATGGATGAC
AATTTTGACTGGCAAGATTTTGGGCAGAACCTGGGGGGGATGTCGAATGGGGTTTGGAGCTCGCAAGGGTTGTGAGGGCG
TTGGTACCGAAATAGAGTAGAGACAATTAGACATGTGGGCGGCAGGGTCGGTCGGAAAAGGCAAACCTACGAACGACACG
GTAAGCATGTATGACGGGGTTGGATTGGATGGTAAGGAGGTAATGGATGGATGGTGCATATAGGAGTCGTCTGTATTTGT
TCGTTGCGGTTTTTTTTCGTTTTTTTTCATGTGCTGTACCGTGGGAGCAGAGATACCTCGTCGAGTTTTTGCGCGCCGTT
ATTTTGTAAAGGTTAACGGATACCCGGTTGTGTAGTGCGTAAAGCATGTTACAGTTGCATGAAGCTTTAATCCCAAGATC
TTAGTACGAAGTTGTTGTTTGTAATAGCTTCCAGCTGCTTTGCGTGACATGGTCCAGTAGACGGCTGAGTCATCGGACAA
AACACGTGCAATGGATGGATGGAGGAGGTTGGGCTGCGCCTTCCCCAAGTGAAAGCACGCCGTACAGCTTTTTATCGAGT
ACTTTTCTGCACGAAGTGACGCATTCCTGTTTGATCAGCAGCAACACGACTGACAGCGCGACGACGGGATGGACGAGCAG
CGGACATGGCGGCCGCTGCCGGCGCGACATGCGCAAGTGCCGCAGCTGGTGGTGTCGGCGACGTTTGGGGTGGCTTCGTA
TGCGGTGCACGTGTCCGACCTGGTGCACGTCTGGACGGAAGAGCTGAGTCGCCGTGACATCTGCATGCGTGGTTTCCGCG
AGGACACGCCGATCGACCCGAGCTACGATGCCGAGCAGATGGCCGTCTTCCTGGACAAGCTGCGGGCAGCGCTGGAGCCG
GAGCACACCGAGCACGGGATGACGAGCCTGAGCTTGAGCCTGGCCTCTGCAGACGGATCGGATGGTGCAAACCTGATTCT
GCACCTGAGCGTGGAGCTGCCGGGAGGCCTGCGGCCGCTATGCTGGCCCATGTGCCTGGCACGGCGGCAGTCTGCCAGCG
CGGTGGCGGATGAGCTGGTGCGGCCGCTGCTGCACGACCGGCTGGTGCGCGCGCGTGAAGCGACCGCGCTGTCTGCAGCC
CTGCGCGAGAAGGACGTCGTGATCGGCCGGCTGGCCGACAAGCTCGAGGCGCTGGGCGCCGGGCTCGGCAGCGTGTTTCC
GGCGCTGGCAGGGCGACATCCACAGCAGCAGCAGCAGCTGATGCGTGCGGCCATGGAGGAGCGCGTGCCCGGGCTGGCGC
CCTTTTCTCTTGACAGTCTCCGAAGACAATTGCAGAAACAAGAGGAGACGACAGCGGACAGATCGCTGGTGGAAGAAGCG
CTTGGCGATGGCGACTCGCTCACGTGTGAGATCGGCGAGCCCTCGGAGCCCCGGCTGGACGGCTGGTGGAAGACGCTCGG
CAGCGGCCTGGGCGTTTCGCTGCAGCCCACGGTGAGAAAGGAGACGGTCCTGGCAGAGAAGCCTCCTCCGGCTGAAGATG
CTGCTGCTGTCGCGGACGACGACTACGTCCAGCGGGAGACGCCAAAGAAGAACAGAGGTGCTGCTGCTGAGCCACCATCC
TCACCGACTCCAAGAGCGGTCTCACCATCACCACCACTACCACCAAGGCCGACTGGCAAAGCTGGCAAGCTCGGCAGGCT
AGGAGCCATTGGCAAGAAGAGAGCATCGACACCACCGGCGCCACCACCCGCAGAACCAGAGGCTGCAGCAGCCGTGCCAT
CACCACCGCTAGCAGACAGTGCCAAGGGGGTCGGGGAAGCAGACGGGTCCGATACGGCATCGGAGGCCGGAGACACGGCT
GAACCACCGGCCAAGAAACAAGCGGAAGAGCAGCAGCAGCAGGCGGCACTGTCTGCAACAGACGTCTCAGTGCGTCCCAA
GTCAGCAGGTGGCCGCAGCCTGGGAAGGATCGGCAAGGGCAAGAAGCCGGCAGCAGTGGAGGCGGTAGCAGAAGCGGCTG
CGGTACGAGTCGCTACAGAGGACAAGAAGGCCGAAGACGCGGCGAAGCAAAAGGAGCGGCTCCAGCAGGTAGTAGAGAAG
CAGGCGGCACCAGTACGGAAGAAGAGGAAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62