GenePrediction:GLEAN_4579 Details

Name: GLEAN_4579
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1846300..1844829 (- strand)
Length: 1472
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1846300..1846121 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_167:1846030..1845870 (- strand)
Length: 161
Type: CDS
Source: GLEAN
Position: GCSC_167:1845577..1845468 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_167:1845339..1845134 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_167:1844981..1844829 (- strand)
Length: 153
>GLEAN_4579 class=GenePrediction position=GCSC_167:1846300..1844829 (- strand)
ATGAAGAGGCTGCCAGCAGCGACGGCCGCGCCAACTATGGCACAGTTCCTGGCAGCCGCTCTAGTAACCGCGGAGGCAGC
CATCGTACCAAATGAGGAGGCCGTAGCAGTGCTAGATGCAGTAGTCTTGACCGCAGCGGCGGTGTCACCAATAGTGGTAG
CTGCAGCACCGCCAGTGCAGGTGGGTGGATGAGAAAAGCGAAACACCTGGGAAATACCTGCTCACTCGCCCGAATATTCA
ATCCTTTGACGGAGCGAAACCAATAAGAAGACGGGAAGCATCTTGGTGAACGTGTCATCGTCTTACGCTGGCGTCGAGGT
GGTGACACCGACTGACGACTCCCTTATGGCTACTGACGACCTCCTTATGGCCATTGACGACCCCCTTATGGTCATTGACG
CCGACCAACGGCCGCGGCGCAAGATTGACCAGTTTGTCATACCGATTGTGGCTGCGGACCAGTTTTGCAACATCTCAAGC
CAATTACGGGCTTTAAAATAGTTGCATTTCTTATCAGTTGTTACATAGCTTGTGAAAAAAGGAACTTTTGTGAGTCATAA
TTTTGGCAAGGTTCATCTCGTACCGATCTCGCAAGATCGGGGACTCAACAGAACTTGCTCACGCATAAAATCACATATTA
CGCTTTTCGAGCACAACTTTTCCATCAAACCCTCAAGAAATATATGAAAGTGAGCAGTCTGAGAGCTGAAGCAAGAATAA
AAGAATGGCAGACACAACTTCCGCTCCTAAGCCGCGCGTCGGCGTCGCTGCCGTCATCAAGAGCCTCGATGGGCACTTTT
GCATTGGTCGAAGGAAGGGATCCCATGGTGTTGGTGTGTGAATATACCTATTCTAATTTGTGCCCATGGTTGGAAAGTCA
GCAAGGTCAAAAATAAGCCTTACGGAATTATGCACGGGCGCGTCTCCTTTCCACTGAGAAACTGACTCTACGAACTTTCA
GGAAAATGGCAGTTTCCAGGTGGCCACTTAGAATTTGGCGAGGACAGCCTTGCCTGTGCTCGCCGCGAGACGCTTGAAGA
GACAGGTCTCAGGGTACGGCCGTTGGGAATCATCGCCGTGACCAACGACATCTTTGGGCAAGACAACAAGCATTACATTA
CAATATGTGTTGTCTGTGTCCGTGAGGACGAGCAGCAGCAACCCCAGGTACGTCAACAAAGGACTGAAGATAAAAATAAA
TAAATAAATGCGGATTGATGGAAAGAACGCGATGAGAGAAGAGCTTGGGTGCAGTCAAAGGGCCAGGATGTGTCGTTGGT
GTGTATTGACATATCGGCTAGAATCTTGAACCTCTCAAGTGCGAAGGCTGGCGTTGGGAGCGATGGTCGGTCATAGAAGA
GCTGGCCAAGAAGGGCCCTGATGCCGCCGATGGCCTTTTCCTCCCCATCATCCACATGATTGAACAGTTACAAAACCCTC
CTTGGATCGACCTCGATGGCTGTCGAGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62