GenePrediction:GLEAN_4580 Details

Name: GLEAN_4580
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1843394..1841667 (- strand)
Length: 1728
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1843394..1842896 (- strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_167:1842868..1842696 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_167:1842596..1842342 (- strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_167:1842287..1841667 (- strand)
Length: 621
>GLEAN_4580 class=GenePrediction position=GCSC_167:1843394..1841667 (- strand)
ATGTCCGCGTTGTTGTGGCACGGTGCTCAGGCTGCCTGGGCGCGGCTGCCCGGTTCCGACCGAATCCCAGTTGTGCTGGT
CATTCCGGCCATCCTCACAGCTGCTGCAGTGCTGTCGACAGTGAGCCTCTGCATCTACCGGCTCTGGTTTCACCCACTGG
CGCGTGTGCCGGGTCCCTGGCTGGCCGCCTGCTCGTCGTTCTGGCTAGCTTGGCACTCCTTTGTGGGCGACGAGTGCACG
GCCGTCTTCCGGCTGCACGAGAAGTATGGTCCCGTACTGCGTGTGGGACCGAACGATGTGGACATTGCCGATGCCGACGC
CGTCAACCCGATCTATGTGGAGCGTGGCGGCTTCGCCAAGACGGCCAACTACTCCAAGTTTGACGTCGACGGTCACGCCA
CGCTCTTCTCGTCGCTGACCCGGGACTCTCGCCTTCCACGGGCTCGTGCCGTGGCACCACTCTTTGCCACGGGCACCATC
CGGAAAGCGTCGGGCGTGGGCGAAGACGAAGAAGGCGGAGGCGGAGGGGACAATGCGGTCGCCATGATTGTCGAGCGTTT
TGTCGAGTGTGTCAAGCTGCACGCAGACCACAGCCGTGCGACCGGTCGTCCGGTGAACGCGCTCCTGCTCGGCCGGTCCC
TGGCCCTGGATGCCGTCAGCACGCACCTCTTCAAGCAGACGTACGGGGCCTTGGCCGAGATGGCCAAGCTGGCGACGATG
GACAAGGCCGGGGCCGAGAAGGCGGCTGAGAAGCACGGACACGGACACGGACACGGACACGGACACGGACACGGACACGA
AAACATGTCGGCAGCACCGTTTGTCGACGCCTTTGTGGGTGTGGGCGCCTTTTTCAACCTGCACGCTTGGCTGCCGGGCT
GGGATATGAAACTGATGGATCTGATTGACCGCTTCACCGGCACCATGGTCACACCCGACACTGACGGCTCCATGCAGAAG
ATTGACGAGTACACCATCGGGCTGGTCGAGACAGCGGTACCGGGCAGCGGCAGCTATGCGAGCCGGCTGCTGGCCGCCGG
TACCAAGACGCGAGCCAAGTCTGGCGGCGACGGGAGCATGGATTCCGAGGAGATGGCCTGGCGCAAGCAGGTGCAGGCCG
AGTGCAAGGATGTCTGTTTTGCCGGCACCGACTCGAGCGGCATGAATATGGCCATGATGCTGTGGCAGCTGTCGCGGCAT
CCGGACGTGTATGCTCGGCTGCAGAGGGAGCTGGCCGCCCAGGTCGAGGCCAACGGACCGGCGACTGACATCACGACGAA
CTCGTACCTGCGCGGCGTCGTGCGCGAAAGCCTGCGGCTGTCCTGGGCAGCGCCCACACGGCTGCCTCGTATTGTGCCAG
CCGGCGGAAAGACCGAATCGGCTGGCTGGGCCTTTGGCGGCTACGTCTTCCCACCCGGCACTTCTGTCGGCGTGGCCTCA
TTTCAGCTGCACCAGGATGAGGCCGTCTTTCCCGAGGCCACCGCCTTCCGACCCGAGCGCTGGCTGCAGCCGACTGAGCG
AATGCTCAACTCCTTCTTCGCCTTTGGCAAGGGCGGCCGCGCCTGCATCGGCCAGAACCTCGCCATGTCCGAGATGCTGC
TGGGAACGGCTCGACTCGCCCAGTCGGACGCCCTGCGCGGTGCCACTACCGTGCGCGATCACGTCGACATTCTGGAGTGG
TTTAATTCCCGCGTTATCGGAGAGGAGGTCCTGCTGACGTTTTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62