GenePrediction:GLEAN_4583 Details

Name: GLEAN_4583
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1827358..1824987 (- strand)
Length: 2372
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1827358..1826756 (- strand)
Length: 603
Type: CDS
Source: GLEAN
Position: GCSC_167:1826675..1826618 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_167:1826555..1826452 (- strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_167:1826355..1826015 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_167:1825665..1824987 (- strand)
Length: 679
>GLEAN_4583 class=GenePrediction position=GCSC_167:1827358..1824987 (- strand)
ATGACGGACGCAAAATCGATGGAAAAGGCGTCGCCGGACGAGATCTCAACGGCTACGGATGTCCCAGAAGCCACGACAAA
GCCGGTTTGGGAGCGACGTCAGATGAAAGATCTCGAACGGTGGGACAGTCAATCCGAGCCAGAGCTTTCAGATACGGAGA
ACGACGGGAAGATGGAGTGTGAGCCAGAGTCGGAGTCGGGGTCAGAGGCGGAGACGGACTCCAGTGTAGGATCCGACGAC
TACGACTCGTATAACTATCCCGTCTTCAAATGGCCATCACGCTATATCTGCACAGATCGTCAGGGCGAGGCTTTGTGGTA
TGTGCGGGAAAGCCTTGCCATTCAGTCCGTCACCTCCATCTACGAGTTTCCAGGCGACCCAGACAAAAAGGCATATATGC
TGGCCGAGTGCATTTACGCCTGGTTCAAGATGTTTCCTGAGGAGACACAGGTTATTTTCACTTGGTACTACGAAGCCATC
CAGCAATGCCCTCAGGACTATCCGCTGGTGCAAATGCATCCGCTGATGCAAACGCTGGTAAAATGCGCCGCCATCTTGAC
CAAGGAGTGTTTCCGAGGACGCGAGAACAGTCTCGGTCCCGAGGTTAGTATCGTGTCGCGTCCCCGAGACAAGATTATCT
TGCTGCTCGTGCCATGTTCTGATGTTTGCGCTCTTGCGGACAGGAGTATAGGCGAAGTGGCATTGACGATCTCTGGTTTC
TGTTCAGAGACCAATGGGACAGTAAGTGCGGCAATAGGAACAGGGGCACGCGGGAGGGCACGAGGATGCTGACTGATGAC
CAGGTTTCGATCCAAGTTCTTCGAGGACGAAAGCCCTCCAGAGAGAGAGAAACAAAGTCACATTTCTCGCCCACGTCGCA
CGTCTCGGGGAGATGGAATGCGACCAGGTATGCGATTATGTGGGTAGGGAATTGGAGAGTACTTTACTCTTTGGCAGAAA
CTTGCGCCATGTTGCAGAAGCTATCATAATCTGCGGCGAGCAGTTCTGCGCCACGATGATCCCCGGTCGCGTCGACGAGG
ACACAACTACTCACTTTATGACCGAAGATTTCTTTCGAAGTGCCGGCGACGTGCGTCGACATTCTCCGGAGCAATGGCTG
CTGTGGAAGCAGCTGATACGGATCCGGGCCGAGAGCGATGTGATCATGCAGCGCAGCCCCGACACCGTCTGCTCCTTACA
AAATGCCTACGACAAGATGGGGGAGATAGATGCGGCCATCTATGCAGAGCACCCGGAGTATCCACGAGCAGACGGAGCAG
ATCTGGCACCAGTGCCGTCCTGGCATGTGTCCAAAGAGGGGGTGGAGGAGAAGGAGGGGAAGGTGTATGTGAAGGATGAG
AATGTATGAAAGCAGGATTGATGGCTTTTCTTTTGCTGTTAGTTGTTTGCTGCTTGTTATTTCCTGTCGAGTTGTTTGAA
TCCATGCTTGTGGTCCAGTGTATTTTTCGTTAAGACAAGGTCCCGAAGATACTGTCCTTTTTCAGATGCACCCCGCATTA
CGTAAGCACTTGGAACGAGTTCTGCTCCAAGATTCTCACTGCAGCAGCATCTGAGTTTGATTCCAAATCTGCCCGAATTG
CCGGTCGCAGGCCGCCTATAAAGAGCGACACGTCCTGGCCAAGACGCAGAGAAGAGATTTTGTCTAAACTAGCTCGCAAT
CGCTCGTACGCAGCACATCCACCACATCCACTACAGCCTCACGCTTCATGACAGCTTTCCTCAGCGCCATCACCCGCCTC
GTCCACCTGTCTGTCCGCGGCTCCGGCAAGATGTCCATCGTCGACGGCTCAGGCACCTCTGCGCCTGCGTCTGCAGCGTC
TGCGCCCACGCCCCCGGGCGCCCAGATCGCCACGGTCGCCGCAGGCTGCTTCTGGGGCGTCGAGCACGCCTACCGGCAGC
ACTTTAAAGCGGACGGCGGTCTCTACGACGCGCGCGTGGGCTTCGTCGGTGGCGACACGACCAGCCCGTCGTACCGCTCT
GTCTGCAGCGGCACTACCGGCCACGCCGAGGCCACGCGGCTCGTCTACGACCCCGCCCGCATCAGCTACCGTCAGCTGGT
CGAGTTCTTCTACCGCATGCACGACCCCACGACGCCCGATCAACAGGGCGCCGACCGTGGCTCCCAGTATCGCAGCGCCC
TCTTCTTCCACGACGCCGAGCAGGAGCGCATCGCCCGCGAGATCACCGCCCAGGCCAACGCCCAGTGGTGGGGCGGCCGC
ATCGTCTCCGAGATCCTGCCCGCACAGCAGTGGTGGGACGCGGAGGAGTACCACCAGCTGTACCTCGTCAAGAACCCGGA
CGGCTACCAATGCTCAAGCCATCACGTCCGGCCCTTTCCCGAGCTCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62