GenePrediction:GLEAN_458 Details

Name: GLEAN_458
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1911997..1912428 (+ strand)
Length: 432
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1911997..1912100 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_167:1912236..1912428 (+ strand)
Length: 193
>GLEAN_458 class=GenePrediction position=GCSC_167:1911997..1912428 (+ strand)
ATGTCCGCACTCAATCCAAGTGTAGACCTCGTCGACAATGCAGCAGCCTATAACGCTGCCATTGCTGACGCGGAAGCAGA
AAAGAAGAAGAACCGCGGCTCGTAGTTCGTAGCGCTCCTATGAAAACAACATAAACTCATTCCACGGCAAACTTTTAAAG
GCGGCACCGAATATTCAGATGTCAAGGTGGCGTCGATCCTACGCGACTTTTTGCAGCCGGACTGCAAATTGCCTCCCAGT
CAGGTGGTGACGTCAATCTTGGAGCTAATACCTACAGATGCATCTGAATATGGCGAGGTTTGCGGATTTGGCCAGATTTG
CGTTGAGCTCGCTGAGCAAATCCCCTACTACCACCCATCGCAGCTTAAGCTTGTTAAGCTCCTTCAAGAGCTTGGACAGT
CCTCCAAGTTCAAGTCCAAGTATCCGCTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62