GenePrediction:GLEAN_4598 Details

Name: GLEAN_4598
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1747284..1744243 (- strand)
Length: 3042
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1747284..1745766 (- strand)
Length: 1519
Type: CDS
Source: GLEAN
Position: GCSC_167:1745708..1744243 (- strand)
Length: 1466
>GLEAN_4598 class=GenePrediction position=GCSC_167:1747284..1744243 (- strand)
ATGTTTTCGTCCGCGCTCAAGTCGATCTCGTCGACCAACATCAACAGCCACTACAGCCTGGCCGCCACCCCGACCTGCAC
GGCCGGCCCGTGGAAGGTGTACGATGCCCGGCACCGGTCGAGCGGCAAGGCCTGCTCGGTCTTTGTCTTTGACCGCAAGG
TGCTGGACGCGCACGGCAGCAGCAGCAGCAGCGGCGGCGGCCTGGGAAAGCGAGCGGGGGCGGCGGCGTTCCGGCGGGCA
GCCGACGAGGTGGTGGCCCGGCTGAAGCGTGAGGCATCGGCACTGGCCCGGCTGCGCCACCCGAGCGTGCTGGAGCTGGT
CGAGCCGGTCGAAGAGACTCGCGGCGGCGGCCTGCAGTTTGCCACAGAAGCCGTGACGGCATCGCTGGCGAGCCTGTTGG
CAGAGGGCGATGTCGAGATGGCGACAGACAGCCCGCGGACCCGACGACGTCGTCGCGACGAGATGGACGTGCTCGAGATC
CAAAAAGGCCTGTTGCAGCTCGGAAAGGCCCTCGAGTTTCTGCATGAAAAAGCTGGCCTCGTGCACGGAAACTTGACCCC
CGACGCTGTCCTTGTCAATGCCAAGTCCGACTGGAAGCTCAGCGGTCTCGGCTTCAGTGTTGGGGCTACCAGCAGCACCG
CCGCTGTCGCTGACATGTTTTGTTTTGGTGGTGATCTCCGGCTTCCACCTTCTGTGCTCGCCAGCCTCGACTATGCTGCT
CCTGACGTCGTCATTGACGGTCAGCTCGGCCCGGCTGCCGACATGTTCGCTCTCGGCCTCCTCTGTGTCGCCCTCTACGA
CGACCCTCATCGTTCGCCGCTCGCTGCTGCTGTCACTAGCAACAACACCAACAGCGTCGCCGCGTATCGCCGTCTCTTCG
CCTCGCCTTCTTCCACTCCTTCGCCAGCCAACAACTTTCTCGCTGCTCGCCCTCTTCCTCGCGATCTCGTCGCCCATGTG
TTGCCTCGGCTCATCGCCCGTCGTCCTGCCCAGCGCATGACTGCCCGCGAGTTTCAGACCAGCGAGTACTTTGACAACAT
CCTCGTCTCCACCATCCGCTTTCTCGACGCCTTTCCTGCCAAGACCCACGGCGAAAAGACTCAGTTCCTGCGTGGCCTTC
GCAAGGTCCTGCCCTCTTTTCCCCGCTCCGTCGTCGAGCGTAAGCTGCTGCCCGCTCTGCTCGACGAGCTCAAGGACCGC
GAACTCGCACCCGCCATCCTGCACAACATCTTCGCCATGGTCGACCTGCTACCGTCTGCTCGTCGCGCCGTCTCTGATCG
TGTCTTGCCTGGGCTCAAGGTCCTCTTCCTCGGCGCTGCTGCTGCCGGCACTCCGGCTGCTGCTGGTCCTGCTGGCTCTG
TCCCCACCATTTCTGGTACTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCCAATGCTAAGCAGCCCGAACGTGATCCTGCC
CGGGATGCCGCCTTGATGGTTGTCCTCGAGCATCTGTCCACTCTAGCCGCCAACACCACCGGCAAGGACTTCAAAGATGG
TGCGTGCCACACTCTCACCCACCCTCCCTCTCGGCACTAACAAAAACAAAAAACAGACGTTATCCCCATCGTGGCCACTG
CCCTCGAGTCGCCTGCGCCGTCTGTCGTCGATGCTGCCCTGCGCAGCATTCCCGTCATGCTGCCTGTCCTCGACTTTAGC
ACCGTCAAGCACGAGCTCTTCCCCGTCGTCGGCGCCATCTTCACCAAGACCAGCAGCCTTGCCATCAAGGTCCGCGGCCT
GCAAGCCTTTGCCATCCTCTGTGGTGGTCGTCCTGACGGTGATCCCGATGCTGACGACGGCTTGAATGGCGCCCACTCAT
CCGCCCCTTCCACCGCCCTCGACAAGTACACCATGCAGGAGAAGATCGTCCCGCTCGTCAAGGCCATTCGCACCAAGGAG
CCCGCCGTCATGGTCGAGGCCCTGCGCGTTCTGCGTGTCGTCGGCCGCGCCGCCGACGCCGACTTTGTCGCCCTCGAGAT
CCTGCCCATCCTCTGGACCATGGCCCTGGGGCCGCTGCTCAACCTGCAGCAGTTTCAAGCCTTCATGAAGCTGATCCGCT
CGCTGTCCGCCCGCGTCGAGGACGAACAGTCCCGCAAACTGCAGGACCTGTCGACCGGCTCCGGCCATGATGGCGGCCTC
GATTCCATCTCCCGCAACGGCACCCCCTCACTGATGGATGATCTGTCTGCCCTCGGTGTCACCGACAACAAATTGTCTGC
CTGGGATGGCGCCGGCGAGACCGAGGACGACTTTGAACGCCTGGTCAAGGGACGGGCCACCGCCAGCAGCAGCACCACTG
CTGCCACCAGCGGCATCCTCGAGGGCACCTGGGCTGGCTCTTCAACTTCACCACCGCTGCGCTCGCCCCGCGGCTTGCCT
GCTTCTCGGCTGAGCTCGTCGTCGTCTGCTACCGCCACCGCGTCGGCTGCTGCTGCTGCTGCTGCTGTCGTCACGCCCTC
CTTCTCTTGGTCCACGCCCAGCAGCACCGCTGCCTCCATGCCCGCAGCCCGTCCACCCGCTCCGTCCGATCTCGGTGGCT
TTCCCTCCATGACCCCGTCGTCCACACAGTTCTCCCAGGCGCTGCCGGCACGGCCAATGATGGCCAACCGCAACAGCAGC
AGCGGCAGTAGCTGGACCACCCCCAACAACAACGGACCAGCATCGTCAGCCTTTTCGCTGCCGCCACCACCCGCCTTTAG
CCTGGCGCCACCGCCAGGCGGCAGCAGCAGCAGTTTTGGCAATGGCATGGCCAGCATGACAGCGCTCTCGGCAACACCGG
CTGCTTCCTCAATGGCAGCTCCCAACTACAACCGAGCGAGCCTCGGGTTGGCACCGTCGGCCAGCAGTGGTGCAGGAGCT
GTAGGCATGATGGGGTCAAACATGAATATGGGTATGAACATGAGCATGGGAATGGGCATGATGAGCCTGAATTCAAACAA
TGACAACAACAACAATAATGGTGCAATGATGTCGGCGCTGCCCGGCAAGACAGGACTGGACAAGTACGAAAGCTTGCTAT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62