GenePrediction:GLEAN_45 Details

Name: GLEAN_45
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:330280..331812 (+ strand)
Length: 1533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:330280..330425 (+ strand)
Length: 146
Type: CDS
Source: GLEAN
Position: GCSC_179:330502..330515 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_179:330575..330637 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_179:330698..330792 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_179:330858..330949 (+ strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_179:331006..331648 (+ strand)
Length: 643
Type: CDS
Source: GLEAN
Position: GCSC_179:331714..331812 (+ strand)
Length: 99
>GLEAN_45 class=GenePrediction position=GCSC_179:330280..331812 (+ strand)
ATGTCGTCTCTCTCGGCCGCCGCCGTGCGGTCTTCCAAGCAGATGATGGCCCGCCGCAACCTCTTCCACCACCACCAGCT
CCGCGCTCTCTCCGACGTCACCATCACGCGCACCGGCAAGCCCATCATCCGGACCCAGGGCGGAAGGTACGTCCGCGCCA
AGCGAAGCCTTGCTCTCGTCACCGCCCGTCTGCTAATCCCTCTTCGTTCTCTCTGCATCCAGATCCTCTCTCGGAGGTAC
GCGAGCTTCCCATGTCCCGACCACGGTCCCTGTTCTAATCGCGCTCCCGCCACAGGTCACACAGCTACGGTGTTCGGTGC
CTCCGGCGCTCTCGGTCGCTACATTGTGAACCGCCTCGGTGTGTATAGCCGGACGAGCTCGACAAGCTACCCATGCTGAC
AGTGCCATCCGCTTCCAGCTCGGCAAGGATGCACCGTCGTCGTGCCCTTCCGCGAGGAGATGACCAAGCGGCATCTGAAG
GTGTCTGGTGATCTCGGGCGCGTCATCTTCATGGTATGAACTCCTGTCCGGTCGACCGGCCCGGCATCCTGTCGCGCATT
CTCTCACACGGAGCCCAGGAATACGATCTGCGCAACACAGCTTCCATCGAGGAGAGCGTGCGGCATTCCGACGTCGTCTA
CAACCTGGTGGGACGCAACTACCCGACCAAGTATGTCTGCTGTCTGCCGCCGTACTGCCTGCCCGATGGCGCGCTGACCT
GTGCAGGAATTTCACACTCGAGGACGTGCACGTCGAGGGGGCCGAGCGGATCGCCGAGGCCGTGGCCAAGTACGACGTCG
ACCGGTTCATCCACGTGTCTTCGTACAACGCTGCCGGCGCCGAGACGTCGCCGTCCGAGTTCTTCCGGACCAAGGCGCTG
GGCGAGGCGGCCGTGCGGGACATTTTTCCCGAGACGACAATTGTGCGGCCGGCACCCATGTTCGGCTTCGAGGACAGTCT
GCTGCTGCGGCTCGCTGGCGTCTACAACCTGCTCACGTCCAACAACATGCAGGAGCGGTACTGGCCCGTCCACATCATCG
ACGTCGGCCGGGCGCTCGAGCTGATGCTCTTTGACGACAACACCGCCGGCCAGACGTACGAGCTGTTTGGGCCCAAGAAC
TACTCCACCGCCGAGATCGCCGAGCTGGTCGACCGCGAGATCTACAAGAGCCGCCGCCACATCAACGTGCCCAAGGCCGT
GCTCAAGCCGGCCGCCACCCTGCTGAACCGCCTGCTGTGGTTTCCGGTGATGTCGGGCGAAGACGTCGAGCGCGAGTTCA
TCGACCAGACCATCGACGAGACCGTCAAGACGTTCAAGGACCTCGGCATCGAGCCCGACGAGATCAGCGACTTCACCTAC
CACTACTTGGTCCGTCTGCCCCGCTCGTGTCTGCAAGTCCTGGCCCTCCAGCTAATGTCTCTGACCCCTTGCAGCAAGGA
TTCCGCAGCTCGTCCTTCTATGACCTGCCGCCGGCAACAGAGCGCGAGAAGCGCGAGGACAAGCAGTACCTGCACGTCGT
CGACGACCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62