GenePrediction:GLEAN_4601 Details

Name: GLEAN_4601
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1716487..1714101 (- strand)
Length: 2387
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1716487..1715651 (- strand)
Length: 837
Type: CDS
Source: GLEAN
Position: GCSC_167:1715573..1714101 (- strand)
Length: 1473
>GLEAN_4601 class=GenePrediction position=GCSC_167:1716487..1714101 (- strand)
ATGGAGACGGAGATCAGGGCCATCATCCCGAACATTGACCCGGTGGTGTCGGAGTACTCGGTGGGCTACCTGACCCATGC
CTCGACGGCGTGGTCAGGCGGCAGCGGCGACGACGGCGAGGAGGAGGCCGGCGGCGGCGATGCAGCGCAGCCACTAGCCG
ATGCGGCGACGGCGGTGACAGACCTGTTGCTCTCGGCAGCGGGCGACACGGCCAGCACGGCACAGCAGGACAGCATCAGC
AAGCTGGTGGCCAAGTGGGTAGAACGATATGCAGAGGAGGCAACGGGAGCCAACGGACGGCGAGGGGCGCCGTCAGCGGT
ACGGCGGCTGGACCAGACGATTCAGGTGAGCGCGCAGCGCAACATGTCGTCGACGCTGGCGGTGGCGACGGGCGGCAGCG
TTGATCTGGAGTCGGTCAACGCACGCAAGGTTGAGTCCAAGGTGGACCGGCGCAAGCTGGAGAAGGCAGAACGCAAGATC
GCGGCCAAGCAGAACAAGAAGACGTACAAGACGGTCGAGTACGAGGCGTCGCGGCTGCTCAACCAGCAGGACGAGGCGCA
GTCGTACGAGGACTTTTACATGGCCGTCAACCCGCTGCAGCTCGGAGCAGCCGGCGATGCCTCAGCCGGCAAGCCCAAGG
ACATCAAGCTGGACAACATCGACGTCACCATTGGCGGGATCCGCATCCTGACCGACACCAACCTGGCGCTTTCGTACGGC
CACCGCTACGGTCTGGTCGGCCACAACGGTGTCGGAAAGTCCACGCTGCTGCGGGCGCTGTCGAGACGCGAGCTAGCAGT
GCCGCTGCACATTTCGATCCTGCATGTGGAGCAAGAGGTGAGAGATGGCGGACGAGAGGCATTGTGAGGCGAGAGAGAGA
GAGAGAGAAACAGACTGCTGACCCGAGCTGCCAGATCACGGGTGACGACACGTCTGCACTGCAGGCCGTCCTCGACGCCG
ATGTGTGGCGAAAGTACCTCCTCAAGGAGCAGACGGTGATTACGGCCAAGCTGGCGGAGATCGAGACGCAGCGGGCCTCG
CTGGCCGACACATCAGCCGACGCAGCACGGTTGGACCGTGACCGCGAGGCGCAGGACCAGCGGCTGGGCGACATCCAGGG
CAAGCTGTCGGAGATGGAGTCAGACAAGGCAGAGTCGCGGGCGGCGAGCATCCTAGCCGGTCTGGGCTTCTCGGCCGAGC
GACAGCAGTTTGCGACCAAGACGTTTTCAGGCGGTTGGCGGATGCGGCTGGCGCTGGCACGAGCACTCTTCTGCGAGCCG
GACCTGCTGCTGCTGGACGAACCGTCCAACATGTTGGACGTGCCGTCGATCACCTTTCTCTCGGGCTACCTGCAGAACTA
TCCGAGCACGGTGCTGGTGGTGTCGCACGACCGGGCCTTTCTCAACGAGGTCGCCACCGACATCATCCACCAGCACTCGC
AACGGCTGGACTACTACCGCGGTGCCAATTTCGACTCGTTCTATGCGACGCGCGAGGAGCGCAAGAAGACGGCCCGCCGC
GAGTACGAGAACCAGATGGCCCAGCGTGCTCACCTGCAGGCCTTTATCGACAAGTTCCGCTACAACGCGGCCAAGTCGTC
CGAGGCGCAGTCGCGCATCAAGAAGCTCGAGCGCATGCCCGTGCTCGAGGCCCCCGAGACCGAGTACAGCGTGCACTTCA
GCTTCCCCGAAGTCGAGAAGCTGTCGCCGCCCATCGTCCAGATGTCCGATGTGTCGTTTGGCTATGGCGGTCCGGGCGGC
GTGCCGCTGCTGCGCAACGTCGATCTCGACGTCCAGCTCGACTCGCGCATCGGCATCGTCGGTCCCAACGGTGCCGGCAA
GACGACCGTGCTGCATCTGCTGACCGGCCGTCTGCAGCCTGTCAGCGGGCTTGTGTCCACAAATCCGCGCCTGCGCATCG
GCTTCTTCGCCCAGCACCACGTCGACGCCCTCGATCTCACCATCTCGGCCGTCTCCTTCATGGCCCGCGAGTATCCTGGC
CGCACCGATGAGGAGTATCGTCGCCAGCTCGGCGCCTTTGGCATCACCGGCACCACTGGCCTTCAGAAGATGGTCGTCCT
GTCCGGTGGTCAGAAATCCCGCGTCGCTTTTGCCTGTCTCGCCCTCACTAGCCCTCACATTCTCGTGCTCGACGAACCGT
CCAACCACCTGGATATCGAGGCCATGGACGCTCTCGCCGACGCCCTGCGCTCCTTCGAGGGCGGCGTCCTCATGGTCAGC
CACGACGTCACCATGCTGCAAAACGTCTGCACCAGCCTCTGGGTCTGCGACGGTGGCACCGTCGAGAAGTTCCCCGGCGA
CGTCCAGCAGTACAAGAAGCGCATTGCCGCTCAGGCCAACGCTGCCGGCGTCGTCAAGGCCCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62