GenePrediction:GLEAN_4609 Details

Name: GLEAN_4609
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1660165..1657149 (- strand)
Length: 3017
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1660165..1660006 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_167:1659937..1658511 (- strand)
Length: 1427
Type: CDS
Source: GLEAN
Position: GCSC_167:1658446..1657384 (- strand)
Length: 1063
Type: CDS
Source: GLEAN
Position: GCSC_167:1657249..1657149 (- strand)
Length: 101
>GLEAN_4609 class=GenePrediction position=GCSC_167:1660165..1657149 (- strand)
ATGGCTTCCGGAGGCAAGGGCACGCGATGGGGCTCTCTGCTCTCGCAGGCCGTCGCCGGCGTCGAGGCCCGTCTCGACAC
CATGCTTGCCGAGGCAGACGAAATGTCCAAGCAGCCAAAGTCACCGGGCGCACCCCAGTCGCCGGCCAAGCAGAGCTCCA
GTATGCCGACTCTCACAGCTTCCGTCCCCGTTGTCCCCCGGCTTTGCGCTGACACGTGTTCCCTGCAGCCTCTGTACGGT
CCGGCTCGTCTAGTCGGGTCAACGAACGGCTTCAGGAGCGCCTGGCCCGAGCAGTGGCCGCCAAAAATGCGGGCAGTTCC
CGCGGACAGTCGCCAGCACCTTCGTCTACAGCAGCCAACAGCCCGCGGCAAAGCGTCGACATTGCCAGCCGAACGTCTCT
CGACGGCGCTCGACCGGTCTCCAAGGATAAGGAGCCGGTTGAAACCACACGCTTATCTACAGACAGCGCGAGGAGCCCAC
CCTCGACAATGGATACCCAAAATGAGAGCAACGGGGACGGGACGGAGGCAAGTGGTGCTACAGAGATCACCCAAACGGAC
ACGGCAGCACTAGCACCAGCGGCAGAATTGGAGATCGCAACCAGTACGACGTCACCAGTGCCAGCAGAAGGTACCTTGGA
ACCTGGCAGTATCACGGATGAGGATAGCGCGCAACTCGCCAAGACGCTCCAGGAGGCACTCTTGAAGGAACAGCAAGAGC
ACCAGGAAGAAACACACCAGTTTACGGAAAAGATAGATGCGCTGCAGGCGAAGCTGCAATACATGTCGCGCGAGGCGGCA
GAGGCGGCCAAAAAGGCCGGACAGGCAGCAACACCGGGCAGCTTGGAGAAGAAGGTGGCGGAGAAGGACCAGCAGATCGC
GGCGCTGATGGAGGAGGGCAAGAATCTGGGAGTTACAGAGCAGAAGCACCGGGCACTGCTAAAGAAGCTGCGGACGAAGA
TGGCCGAAGACGAGAAGGCGGCGGGCGAGCTGCGGGCAGCACGAACCAAGGCCGAGGCGGAGCTACAGACGCTACGACCC
AAAGCACGACGGGTGACAGAATTGGAGAAGATGCAGGAGGACGGCCGGCGACAACTGGCACAGGCACAGACGGACCTGGC
AGAGGCAAGGGCCGGGCTGACAGCACGAGAGGGCACGGTGGCAGCTCTGCGGTTGCAGCTGGAGGAAGCCATCGAGCGGG
CTGACAAGGCAGCCGCCAAGGTGCAAGACGAGGCTCTGGAGGCGGCACGCAAGCAGATAAAGGAGCTCGAGGAGCAGGTA
GCGACGCTGAGGCTGGAAAAGTCGCTGACTGCCGATCGGGCGAAAGCGCAGGTTGAAGAGTGGCGCGAGAAGGCAGAGCG
AGCTGAGGAGCGGGCGCGCATTGCTGAGGTCGAGGCGATGGCGGAGGTGCAGGTGATGGAGGGAAAGCTGGAGGCGACAC
GGGCGCGGGCCGAAGAGGCATCGTCGGGCGCGCAGGGCGACTCGCAGGCGAAGCTGCTGCGGCAGGTGGAGACTCTACAG
AGCCAGTATGCGATTGCGAGCGAGAATTGGCAGGGCATCGAGGCGACGCTGCTGTCGCGAGTATCTGGGCTGGAAACCGA
GCGTGACGAGGCACAGCAGCGGGAGTCGGAGATGCGGAAGAAGGCACGAGAAGCGGTAAGTGGCTGGTGTCGGTGTCGAT
TGCATTTCTCGACTCTGAACTGGATTCGCTGACAGACAGGCGCTGCGTGCCAAACGTCTGGAGGAGGAGCTCGAAGATGT
GCAGTCGAAACTGCCGCGAGCAGAAGAAGCGGTCGGCGCACATGAGACGCGGATTGCGGCTCTGAACAGACGGGCGGAAG
AAGCAGAGGCAGCTTTACAGCAGGCCCGGGCCGAGCTGGATAGCCAGAGGGTGCAGGCACGCAAAAGACAGGAGCAGCAG
CTGGAGCAGGAGCTCGAACAGGAGCAAGAACAAGAGCAAGAGCGCGAGCGCGAGCGAGAGCAGGGGCGAGGTCGAGGACC
GACAGATCTTCGACGCACCTGGCTTGACGACCTGCCGGGTCGCAGCAGCAGCAACAGCCGGCCCGAGTCGCCGCTGGTGC
AGGGAGGCGGTGGAGTGACGCCCGGAATGCCGACGCGGACATGGAGCTCCGACTTTCTGGGGTTGCAGGGCCTTCCGAAC
AAGCTTCGCAAGACGTCGACGCCGTCGAGCCACGGCGACGCAGCCGAGCGGTTCTCGCTGCGGCGGCCGTCGGGACAGCC
GCCGCTGTCGTCAGTGATGTCAGTGATGTCAGTGATGTCGCCCATGGCCATGTCGCCGACGGCAATCGGGCCCGAAGACG
CGGTGGATGAGCCGGATCGATCAGCATCACCGCAGCTGCACATGATGGGAGGCAGCGGTGGTGGTGGTGGCGGTGGCAGC
GGCGGCACACCACAGCAGACGGACCTGGTGTCGGTGTCGACGGTGGCGGCAGGCCCGTCGGTGCAGCTGGTGGAGCGGAT
GAGTGCGGCCATCCGACGGCTCGAAAGCGAAAAGGTGGCCGCGCGCGAGGAGCTGGCACGCATCTCGAGCCAGCGCAACG
AGGCGCGCGCCGAGGTGCTGGCGCTGCTCAAGGACGCCGAAGCCGGCCGAGCGGCAGCCGATCGGGTGGCCACGCTCGAA
AAGGACGTCAGCGCGATGCAGGAGCGCTACGAGACCACGCTGGAGCTGCTCGGCGAGAAGAGCGAGCTGGTCGAGGAGCT
GCAGGCAGACGTGCAGGATGTCAAGGCCATGTACCGGGACCTGGTGGAGCGGTCGATCAAAGGTAGGGGGGGGGGGGGGG
GGGGGGGGGCGGGGGGGATGGAGGAGGCGGATGGATGTAAAGAGGAAGAGAAAGGAAGAAGAGGACGATGTAGATGATAA
AAGTGAGGCTAAAGAGATCGAAAGTCGGAATACCAGGACAGCAGAGGCAGGAACTCAAGCAGGCAGGGACGGACAGCAAC
GGCGCCGGATCGGGAAGGCGCCAGGGAGGAGCAGAAACGCCCCAGTGTATTTTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62