GenePrediction:GLEAN_460 Details

Name: GLEAN_460
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1913891..1916261 (+ strand)
Length: 2371
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1913891..1915353 (+ strand)
Length: 1463
Type: CDS
Source: GLEAN
Position: GCSC_167:1915565..1915847 (+ strand)
Length: 283
Type: CDS
Source: GLEAN
Position: GCSC_167:1915896..1916261 (+ strand)
Length: 366
>GLEAN_460 class=GenePrediction position=GCSC_167:1913891..1916261 (+ strand)
ATGTATCCGTCCATGACAGCGCCCCAGAAGCAGCGCCGCCAGGCGACGGCCTGTGACTATTGCCGCTCGCACAAGGTCAA
GTGCGACGCCGAGCAGCCGTCCTGTCGGAATTGCGTGCGTCGCGGCATCGAATGCGTCACCGTGAACCTGCGCAATCCCG
GCCTCGACGGAACACGCCAGCTCCCGCTGGGACGAAGGCGAAAGGATGCTCCGAGGACGCTGGACAACAGCTCGGCCGTC
TGGGGCGAACGGATCGACACGGCTGCCAGGCCGGCCGACGAGCCAGAAACGGTCAAGTATCCACCCTCACCCCTGCAGCC
AGCAGAGCGCACGTTCGAAGCTCGGTCGCCCAGCAGCATCCTGCCTGGCGTCTTTACCAGTCCGTTCCACGAGGACACGC
GCGACCCGACCGCAAGCGTGTCCCGGACAGGTTCGCCCAGCACCCGGTCGCTCAACAACAGCACCCCCAGCTTGCCACTG
CTGGCAGACAAGAACGGCTTCCGGGCTCAGGCCGTCGGCAGCGGCAGCAGCCTCTGTTTCCTGGTGCAGTGGCTGGACCT
GTACTTCTCGCAGTGTCCCACCTGGACGCCCATCTTGCCGTTCATCCAGCAAGGCCTGGCATACTCGATGGAAGTTCCGC
TGCCCTTTTCCGTTGGGCCACCCCTGTTGCCATCCAGCGAGACGGCCAAAAAGTACACCGCCCTGTTCTTCTCCCGAGTT
CACCCGGTCTTCCCCGTCATCAACCGGGATGCTTTTGAGGCGTCGCTGGACGTCCTCCGTGCAAAGGTCGCCTGTGTACC
GATGAGCCTGGAGTCTCGTGACTATCCTCTGCTGGCCTGTGCATATGCCGTCTTCAGTGCAGCTGCGGACGAAGAAGCTA
GCGCGGTGTCTCCAGAGGGCACAAAGTACTTGCAGGGAGCGTACCTTTTATATGGTCAACTCGTTGCCACGCCACACTAT
ACTTCTGTGCAGGCGCTTCTGCTGCTCACGTTGATCCTCTACAACCGCAGCAAGAATGGTGCTAGTTGGGGCACTCTGAG
TCAGGCAGTCCGCATCGCCCAGTCCATTGGCCTTCATCGACATGTCCCTCCGTCCGGCTCTGTGCCGGCGACCTTGCCGA
TGACACCTGGAAACGCAGCAGACGAAAACTTGTTTTCCCGAATCTGGTGGGCTGCATACACGCTGGAGCGCATGATGGAG
CTGGAGAGTGGACGACCGTCGGCTATCTACGACGGCGAGTGCAATCAGATCATTCCGACCGTCACGGCTGGCACGCTGGC
TCCCGGGTGCTCGTTTGATTACTTTCGTGCCCTCGTTCAGTTGTCACAGATCCAGTCCCGCGCCATCGTTCTCCTCCACA
GCAACAAAACACAGCGCAAGTCCTTCCGACTAATGTTGCGCGAGCAGGGACGGATCGACCGTGCCCTTGTGGACTGGACC
GAAGGCTTTCCAGAGTCGATTAGGTTTGTGTTTCTATTAGCCAGGAAAATCTCTCTCTTTTTCCTTTTCTTTTCTTCCCA
TTTCTGACAAAAACGAGACCTGGCCGAGATATATTCTGTGGCGCCGGTGAGCTACACTTGGCTACCTACGTCTCTCTTCG
TTACCATCAGACGTAAGTCTTATCGTTGTAAAGCTCTGCGTGGCCGATGGACGCCCACTAACATAGGTGTAAAGGATGAT
TGCCCTGCACCGGCCGGCACTAGTGTCTTCTCCCGGCTTTCTGCGCAACCGCATCAACGAGTACTGCGCCGGAACTCCTT
GGCGAGACCGGCTGCACTTCAGCCTATGCATCGGCGTGGCGTCGGCACGTGCCATGCTCAAGGCCTACAACGATCTGCTG
ATGTATGTCGGCCCGACGCGTCTCATCACCGCCAATCAGATCCTCCTGGCCACTCTTGTTCTGGGCATCTATATAACAAA
GAACCCGCTGAGCCGTTTGAAAAACTCCGACCTAGCGGTATGTCTGTTCCTCTCCATGTTTGATGCCATCCAAGCTGATA
GTCAGATGCTTTCGACATTCTCTGAGAGCATTGAAGAGGAGTACGTGATGATGGGCCAGGACTTGGAGTTTGCAAAGGGC
ATGCAGACTCTCCGACAGCAACTTAGCGACAACATCGGCAGCCACCGACCGGGTCCCCTTGGTATCGACCAAGTCGCAGA
GGCTGCAATCCAACCGAAGGGGGTGGAGATGGACTCGCTATTGCCTGGATTTGACTTCAACACTACTGTGGACTTCAACA
CTGGCCTTGCCAATCTAGAAGACTCCTGGTCGCATTTGTGGAACGAAGACTTTGGCGGATGGACGTACAGCAATGACGAG
CAGGATACGACAAATATGTATGTGTTGGGCCTCCCACAGTCATGGACATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62