GenePrediction:GLEAN_4611 Details

Name: GLEAN_4611
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1647604..1646779 (- strand)
Length: 826
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1647604..1647384 (- strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_167:1647310..1646779 (- strand)
Length: 532
>GLEAN_4611 class=GenePrediction position=GCSC_167:1647604..1646779 (- strand)
ATGTACACGGCAACGGCACCAATCCCCCCGCCCAAGTCTGGCAGCCATGAGGTCAGCCGACGCAGCACTCCGGCAGCTAC
GCAATCGCCCAGACCACCGCCGCCGGTCCCAGCGACATCATCCAGCCTTCCAGAGGCGGTGATGCAGGCTCAGATTGCGG
CGCTGCCGGATACTCCGGACCCGGGCGAGAACTGGCTGCCCAAGATTCTACAAGACAAATCGTGCGTGCTGTGTTGACCT
CTTTCTGATCGTCTTCTTTCTCTGGGCTGTTGGCTGACCGCTTATCCCCACCAGAAAGCAAGACCTGGCCGACATCCTGG
CATCGCCAGGGCTTCTTGATGCCCTCACGCACAGCACGGTCACGAGTCATCCGTCGCTGGCGGCCTCGCACGCGACCCTG
GCCGCCGCCCTCGACGAGAACATGCAGCTCGCCGCCCACCTGCAGGAGCTCGAGGCACGACTGGCACACCAGCGGGCAGC
AACCCAGGCTCAGCTGATGGGTGCCCACGCGCTGGAGCGCTCGTGGCGCAGCAAGCAGGCGGACATGGACGCGGCGCTGG
CGCCGTTTGCGCCGGCTAGCCTGTACCAGCGGCTGGCCGCCGGCGTGGCCGAGCAGGAGCAAGTGTGCCAGGCACTAGAG
GAGAGCTTCCTGGACGGCGGCAGCGGTGGCGACCCGTCGGCGTTGGGCGGCCATGACGGAGCACCGGCCAGCGAGCGGGA
GGCGGCCGACTGGGTGCGACGGTATCGCGAGGCACGGAAGCTGTACTACCTACGACAAGAGAGAAGAGAGCGATGGGATG
AAGGCCGCGTGGGCGGATGGCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62