GenePrediction:GLEAN_4613 Details

Name: GLEAN_4613
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1629320..1628004 (- strand)
Length: 1317
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1629320..1628979 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_167:1628865..1628774 (- strand)
Length: 92
Type: CDS
Source: GLEAN
Position: GCSC_167:1628703..1628004 (- strand)
Length: 700
>GLEAN_4613 class=GenePrediction position=GCSC_167:1629320..1628004 (- strand)
ATGCCCACACTCACCAGATACGCTGTCGTCTCGCTGCCGCTGCGCACCTTTGAGTCCAGCGACCTGAGCAGTGCACTGTC
ATCGCTGCGTGCCACGGTGTCGCCCGACAACGGCTCCCTGCAGCTCTTCCCCATACCCGACTTCAAGATCGGCACGCTCG
ACGCCTTGGTGCAGCAGGCTGACGACCTGGCCCGGCTCGACACTGGCTGTGCCGGCGTGGTCTCTCGCGTGGCCGACTCG
CTTCGTAACATCCTCGACGGCGACGAGGAAAAGGCTGCCCAGCAGAAGATTGTCAACGACAAGCCGACCGAGAGCTACCT
GAACTCGTTTTCCTGGAACAAGGTGCGGTATCGGGCAGACCGGCCGCTGGGCGAGCTCATCGACACGCTGCAAAAGGTGA
GAGGAAGCGAGAGAGGAAAAGAGAGGAAGAGAGAGGAAGTTGCTAATTCGTCTAGGAGCTCGTCAATATCGACAATGACG
TCAAGGCAAAATTCACCCAGTACAGCTCGGTCAAGAGCAATCTGGCAGCATTGCAGAGGAAGCAGACGTGAGTTCCCGTG
GAGAGGAGAAGACTGAAGCCAGGAACCAAAGCGGGGAAGAAACTGACATGACTCCAGCGGAAACCTGGCGACAAAATCGC
TGACGCCCATCGTCAAGCCGTCGCTGCTGGTGCAGGACTCGGAATACCTGGAGACACACCTGGTGGTAGTGCCGACAGGA
GCACGCAAGGAGTTCCTGCAGGAGTACGAGACGCTGGCGCCGATGGTGGTGCCGCGGTCGGCCGTGCAGGTGGCCACGGA
CGACGAGTTTGCGTTGTTCGCGGTGACGACGTTCAAGAAGCACAGCGCCGAATTTGTGCACAAGTGCCGGGAGCAGAAGT
GGACCCCACGCCAGTACACATACGTCGAGGGCGGTCGGGAGGAGGAGCAGCGCGAGCTCGAGCGCGTCGAGCGTGAGGAG
CGCAAGGTCTGGGGCGAGGCGCTGCGGCTGGCCCGCACTGGCTGGAGCGAGAGCGTCAGCGTGTGGATGCACGTGCTGAC
GCTGCGTGTCTTTGTCGAGACGGTGCTGCGCTACGGACTGCCGCTCGAATTCATCACCGTCTTGGTCCGGTCAACGCCCA
AGCTGGTCAAGAAAGTCCAGGCCGCCCTCGACTCGGCCTACGCCTATCTCGGCGGCAATGCCTTTGGCCGCGACAAGAAG
GGCAAGATCACCAAGGACGATGCCGCTCTGTCGTCCGAGATGGCTGCTGCCGGTGTCGGCTTTAGCGATGGCCACGAGTA
CACCGCGTACGTGTACTATGAGTTTGAATTTCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62