GenePrediction:GLEAN_4614 Details

Name: GLEAN_4614
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1609637..1600738 (- strand)
Length: 8900
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1609637..1607901 (- strand)
Length: 1737
Type: CDS
Source: GLEAN
Position: GCSC_167:1607843..1603582 (- strand)
Length: 4262
Type: CDS
Source: GLEAN
Position: GCSC_167:1603520..1602864 (- strand)
Length: 657
Type: CDS
Source: GLEAN
Position: GCSC_167:1601925..1601592 (- strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_167:1601055..1600738 (- strand)
Length: 318
>GLEAN_4614 class=GenePrediction position=GCSC_167:1609637..1600738 (- strand)
ATGTCTGGTCGTCGAGACCAATCCGATTCGGGCCACGGCCGCGATGGCGGCTACGGCTCTGGGGATCCCTCCTACCCTGG
CGGTAGAGGGTATTCGGCAGCGTCAAATCCATACGAGCAGGTCTCGGTGAACCCAGCACACTTGGCGGCGAGTCTGAACG
GCATCGACGACTACTGGCAGCAACCGGCACCGTACAGCGACCATGCTCGCCAGGACGACGCGATGGGGGACAGCGTCGAC
TCTCCCATCGATGCAGCGGCCCTGCAGTTCGCGCTGCCTCCCAATATCTCACAGTCAGTCCGGAGCCGAGTGCCGTCTTT
GGGGCTGCAGCCTCTGTCAAGCGAAGCGTTTCCGCGCACATCCTCGGCCTCTTCGTACTACGCCGACCAACGGCTCGACC
GGCCGTTTGGTGGACCGCTGGACGATCCTTTTGGCGGGTCGTTCGACGATTCCCTGGACGGGACCATGCGCCACCTCGAC
CAGCACGACGCCGGCAACGAGTCGGATCGTGTGCCGCTGACGACCAGCGCGCAGCCCATCTCGGGGGCAAGGGCGCAGCT
CGTCGTGACGCCGACCGAGGAGTACTCGCGGGACAGCTTTCAGACGGTGCGCGATCTGGACAGCAGCCCGTCGCGGTCCC
GCGACACGCGGATGCTGGGCTTCGACCTGGAGACGGGCCAGAGCCGCGGATACGGCGACTCGTTGTCCCCAAGCACAAAT
AGCCGGCGCTCGCGGTCGGCATCGACGTCGGCGTCGGGCGCGCTGCACCGGACGGCGTCCATCATGCGAGAGGTGTCACA
GCGTGTGGTTGACATCAGCGGTGGTGGCGAGGCGTTGGAGGAGCAGGCTCGCCGGTCACGGTCGCTGTCACGGTCGCGCA
ATTCGAGCGTCGACGGCCGAGTTTCGCAGCACGTGGCCGCGGTGCCGATGCTGGTCGATACGTCCTACTCGGCTCAGGCA
TACGGCAGTCCGGCTGAGAAGTCCGGTGTGCCTGGCAACATGACACCGCTGCCGACTCCGGTCTCCGGACACCGGACGCC
GATGGGAAATCCGCTTCGTGGCAAGTCGCTGGGGATCTTCTCGGCCGACAACCCGATCCGTACGGCCATGCTGGAGCTGC
TGATGCAGCCGTGGGTCGAGTCGGCCATTCTCGGGCTGATCATCTTCCAAGCCGTGCTGCTGGCCGTCGAGGCGGCGCCC
GACGTCTGGTCGCCAGGCAATGCACGCACCGATCGGTGGAGCTCGTCGTGGTACAACTGGTCGATGCTCGGACTCTTCAT
CGTTTTTACGGCCGAGATCGTTGTGCGCGTCATCGTGTCCGGCTTCATCTTCAACGCCCCCGAGTACAGCACGATCGATC
GCAAGGCCGGCATCCGTCACGGCCTCCGAGCCGCCGTCACCGATCAGTACCGCAACTTCTTCCAGCCGCAACGCCAAAAG
TCCACCCGCCGGCCGCCTACCGAGACCTTCACGCCTTCGCCCTTTGCCCGCTCTTTTACCTTTATGCACAGCCAGCGCGC
GCCCGAGTCCTACGACGAGCATCGTCGGATGCAGCTTGCCCGGCGTGCGTTTCTGCGCCACGGCTTCAACCGCCTTGACT
TTGTCGCTGTCGTCTCCTTCTGGATTTCCTTTGTGCTCGCCTGCACAGGGATCGAGTACGCCCACCACATCTATCTGTTC
CGCATGCTGAGCTGCCTCCGGATCCTCCGGCTGTTGGGTATCACAAAAGGAAACGCCGTACGTTTTTTTCCAGTTTTGTC
CCTCTGTTTTCCTTCTCTCCACTGACACGTATAGATCATCTTGCGGAGCTTGAAAAAGGCTTCCCCCCTTCTGGTGCGGG
TCTCATTCCTCATAGGCTTCTTCTGGCTGCTGTTTGCCATTATTGGCGTCCAGAGCTTCAAGTCGAGTCTGAGCCGCCAG
TGCGTCTGGCTTGACCCAATGCAGCCGACCAACCTGTCGGCCTCGTACACGAACTCGTTCCAGTTCTGCGGTGGTTACCT
CGTGAACAACACGGACGTCGAACCGACTACGCTTCCCTGGGTCCAGATGAAGGAGCCCAATGATCTGACCATCCTCGTCA
ACGGCTCGTCGTCGGGCAAGGGCTTTATCTGCCCGCGTGGGTCCATCTGCCTCCAGCAGACGGCGCCCTACAACGCGACG
GTCAGTTTTGACGACATCTTCCACTCGCTCGAGCTAGTGTTTGTGATCATGAGCGCGAACACGTTCAGCGACCTGATGTA
CTACACGACCGATTCGGACTACCTGCCGGCAGCGCTGTTCTTTGCGGCCGGCATCGTGGTGATGATGCTCTGGATGACGA
ACCTGCTGATCGCCGTGATCACTTCGTCGTTCCTGCTCATCCGCGAGGAGAACAAGGGCAGCGCTTTCACGGCGGACGAG
AAGAACTTTACGACCGCTCACGTGGATGAGGCGCCGCTACGCCGGTGGTCGTTGAAGTGGATCTACGACAAGATCGCTTG
GTTCTTCGTGCTGATGATCGCGCTCGGGCTGTTTGCGCAGGCCTTTCGCAGCGCAGCGCACGAGAACCGGATCCCGGCCA
TCAATGCGATCGAAATCATGGTGACTAGTCTGCTAGACGTCGAGATCGTTCTCCGCATCGCGCAGGACTGGCGGCGTTTC
CCTCATGCGTTCCGCAACATATTCGACCTCGGCCTGGCGGTGATCACGACGGTGATCTTGATCCCGGAGATCCGGCACCG
GGAGCAGCTGTACGCGTGGCTGACGGTGTTTCAGATCCTGCGGACGTACCGGCTGGTGCTGGCGATCCCGATGACGCGGG
GCCTGATCAAGCTGGTGCTGGGCAACTCGACGGGTATCGCGAACCTGGTGCTGTTTGTGTTCCTCATCACCTTCCTCATG
GCCATTTTTGCGGTGCAGCTGTTCCGCGGCGAGATCACGCCGCTGGACGACGACGGCAACAACATCCGGATCACGTTTGG
CAACATCTTCAACTCGTTCCTGGGCATGTACCAGCTAATGTCCAGCGAGAACTGGACGGTGATCCTGTACACGGTGACGA
CATTTACGACGCGGCTGCACAACGCGTGGATTGGGGCCATCTTTCTGATCGGCTGGTTCACGCTGGCATACTTTATCCTG
GTCAACATGTTCATCGCGGTGATTCAGGAGAACTTTGACGTCAGCGAGGACCAGAAGCGGCTGGAGCAGGTCAAGGCATT
CCTGCAGCGCAAGGAGCTGGGCAGCTCGGCGAGCAACCTCTCGCTGTCGGCCATGTTCTCCTTTGGTCGGCGGCAGAAGC
GCAAGGACCCGCTGGACTACGGCCCGGCGATGATGGAGATGCTGCTGAAGGAGGCGGTGGTGCACGAGTTCTTGAACGAG
GCGTCGGATTCGCTCGAGTCGCCCGACTCGCCGGAGACCCATGGGCACGGCCACGGACACGGCCATGAGGAGGCAACAGT
GATGCAGCCAGGGATCCTGTCGGCAGTGTGGTCGCGGATGGTACGGATAACGACCAGCCGCGAGCCGAACCCATTCTACT
CGAGCATCCGGCTGCACGCGATCAACGAGGCGCTGGACCCGCGGCAGATGGCGCGCGAGGCGGTCTCGGCGACGGCGGCA
CGGCGCAAGGCGCAGCGCGAGTACCTGACGCGCCATCCGTCGTACAACAACTCGCTTTTTGTGTTCTCGCCGCGCAATCC
AATCCGGCGGATGTGCCAGAGCATCGTCGGACCGGGGCGAGGGTCGGAGCGGTTTGACGGGACCGATCCGCACAAGTACC
CGTGGTACATCTTCTCGGCGTTCATCTATGCGTCGATTGTGGCGATGGTGATCATTGCGTGCATCACCACGCCGCTGTAC
CAGAAGGAGTACTTTGACGCGGGCCACACGTTTAGCTCCAAGAACTGGTTTGTGTGGACGGACCTGGCGTTTGCGCTCGT
CTTCTCGTTCGAGATGCTGGTCAAGGTGATCGCGGACGGCTTCCTCTGGACACCCAACGCCTTCTTCCGCAGCACATGGG
GCGTGATCGACGCGGTGGTGCTGATCACGCTGTGGATCAATGTGGCGACGCTCTTTGCCAACGACGGGGCGGTGTCGCGG
GCGGTGGGCGCGTTCAAGGCGTTGCGGGCGCTGCGGCTGCTCAACATCAGCGACAGCGCGCGCGAGACGTTCCACTCGCT
TATGATCGTGGGCGGGTGGAAGATCTTGAGCGCGGCCTTTGTATCGATCTCGCTGCTGATCCCGTTTGCTGTTTTGGGGC
TGAATCTGTTCCGTGGAAAGATGGTCACGTGCAACGATGGCAGCCTGTTGCAGCTGGTCGACTGCTCGGGCGAGTTCCTG
AGCGCGCCATTCAGCAGCGACTGGCAGCTGCTGGCGCCGCGGGTGGCGTCGAACCCGTACTTCAGCTTCGACGACTTTGG
CGCATCGCTGGTGGTGCTGTTCGAGATCGTCAGCCAAGAGGGCTGGGTGGACGTGTCGTTTCAGGCGCAGGCGATCACCG
GCACCGGGCTGCAGCCGCAGTTTGGGGCCGCGCAGGGCAACGCGGTCTTCTTTATCGTATTCAACCTACTGGCAACGGTT
TTCATACTGACGCTTTTCATCTCCGTCTTCATGCGCAACTACACTGAGCAGACGGGTGTGGCCTTCCTGACGGGCGACCA
GCGGTCGTGGCTGGAGCTGCGCAAGCTGCTGCGCCAGATCTCGCCGTCCAAGAGCTCGTACGACGACTCGAAGAACCGGC
TGAAGCGCTGGTGCCACAAGCGGGCGATCGAGAAGCGTGGCAAGTGGTACCTGGGCATCACGGTCGTGCTGGTGGTACAC
CTGATCCTGCTGGTGCTGGAGTACGCGGGTGAGCCGATGTGGTGGAGCAACACGCGCGACTACCTCTTCCTGGCCCTGAC
GCTGGTCTACATGGTCAACATTGCCATCCGCATCATCGGCCTGGGCTGGAGTCGGGTGCGACGCAGTTCGTGGGACATCT
TCAGCATGTGCTCCGTGTCGGGCGCCTTTATCACGTCCGTGCTCTTCCTCTCGCTACACCGTGAAGACACGCTGGTACAG
CTGCACAAGATCTTCCTCGTCGCCATTGTGCTGATGCTCATCCCGCGCAACGACGCGCTGGACCAGCTGTTCAAGACGGC
CGCTGCGAGTCTGTCGACCATTGGCAGCCTCGTGGCCACCTGGCTGGTCTTCTTCATGGTCTTTGCCATTGCCATGACGC
AATCCTTCAGTCTCACGCGCTTCGGCAGCCAGGAGTCGAGCAATATCAACCTGCGGACGGTGCCCAAGGCGCTGATCTTG
CTGCTGCGCATGAGCTGTGGCGAGGGCTGGAACCAGCTGATGGAGGACTACGCCGACATCCGGCCGCCGCTCTGCGTCGA
GGCCGACACCTTTTTTGAGAGTGACTGTGGCAGCAAGGCCTGGGCACGCGTGCTCTTCATCGGCTGGAACATCATCAGCA
TGTACATCTTTGTCAACCTGTTCGTCTCGCTGATCTACGAGAGTTTCTCATATGTCTACCAGCGATCGAGCGGACTCGTC
GACATCAACCGTGACGAGATCCGCCGCTTCAAGGAGGCCTGGCGCAGCGTCGACCCCAACGGTACCGGCTTCATCAGCCG
CGATGCCTTTCCCCAGTTGTTGGCCGAACTCTCGGGCGTGTTTGAGATGCGCATCTACGACCACGAGGACTCGGTCGGCA
GCATCCTCGAGCACGTGCGCAACGACGACTCGCGGTCGCTGGCCCGCCACTCCTCGCTGGCCATTCCCTTTTCGGCGCCG
CCCACCTTCACCGGCGTCGACCTGAAGAAGCTCAACGACCGGATCGGCAAGATCGACGTCGAACGCGTGCGCAGCCGCCG
CCGTCGCTTCAACTTCTTCTACGAGGAGGTCATGGTCTCGGCCGACCCCGACAACGGCATTTCCTTCACGACCGTGCTCA
TGATCATCGCCCACTACAACATCATCAGCGACAGCAAGAGCCTCCGGCTCGAGGAGTTTCTGCGGCGCCGTGCCCGCCTG
CAGCGCGTCGACGAGGAGCTGCGCCGCAGAACGGTGCAGGGCTTCTTCGATACGCTGTACGTCTGCCTCGCTATGCTTAG
TCATACATTAGTAATGATTTGTGCTAACACGTGACAGATACTGGTCCAGGCGCTTCCGACGACACCTCGAGATGAAGCGG
GCGTCGCGCATGACGACGGTGCCACGGCTCGACATCCCGGACATCCTGGTGGACGCAGACGACGACGGCCACACAAACAA
GGTACGGCAGAGACAGCAAACACCGACGACGCCGACGGCCGGGCCGGCGCCATTCTTCCCGTCGCCGCCGAAGCCGTCGT
CATTCCTGAGCGCGGACGATGCGCGGGCGGCCAGCAGCCACAGCAACGGCCAGAGCCAGCTGCACCACCGGTCTTGGTCG
GGCGCGAGCATGGACATCAGCCTGCACGACACCAACTACGCACACCCGCTGAGCCTGCCGTGGACGTCGGGCGTGCGGGC
GAGCACGAGCGCGATGAGCAGTGCCATCAGCACCGGCAGTGGTGGTACCGGTGGCAGCGGCAATTTCCTGCACCAGTCGC
TGTCGGCGCAGCAGCACCACCACTCGTCGAGCGCGTTCAGCTTCGACCTGCAGGAGCCGGGCAGCCAGCCGGGCAGCCAG
CCGGTCAGCGGGGCCAGCAGCAGGCGTGGAAGCGCCGTCAGTCCGGCACACGTGAGCGCGATGCTAGACGACTCCGTATG
GATGGACAGCATCCGCAGGAGCGCCACACACCGACGAGACGGCGGCTGGAACAAGTGAGAGACACCAAGGTCTCGACCGG
CCCAGCGGCATTTCTGTCCACCGTTTATTTCTTGATTTTGTTTGCCAGCGAGCGGAAGCGAGGCGCATGCTCTTTTTTTT
TTGGTTTCCCATTTTCAGCATCTAGAGCGAGCAGACTAATACAAAGTGTTTATGCGTTTGCAAGGATACAAAGAACGGCA
TACGCCGGATGGCTGTGAAGACGGGCAACCCGGCGATACAATGAGCAAAGCACATGGATTGCAAGCAGGTTAGCATTAAA
TCTGTTTCTGCGCCCCTTTAAGGAGTGGCACTGTCGGCTGGGGTACCGCTCAATGCGCCAGTCGACCTCGGTGAAAGATT
TTTCATTTTTCATTTTTCATTTTTCAAACTATTTTCCGCAAAGAATGCAGACCAGGCAGCGCCAGCCACGCCATCCGACT
TGTCATGAGGTGACAATGAATTATTATACGCGCATTGCATTCCGCAGCCATGCAAAGGGGCGTAGCGAATGCGCTACAGC
ACGACTTCACAGTCCTGACAGGTTCTGCCCCTGCAGCGCAGAACGGAGGCATGAAGGGATGGCCGCTTCCTGCCCGTTGG
CCTTGATCGGCCTATATCAGGGTGTTTCACTTTTCAGGGAGAGCTAGGCCGCGTTCGGGTGGATAGGAGCCCCGCTTGTC
GCAGAGGTCAGGACGAACAGTTGCCACGGCCCTTGTTCATTTCGACGAGCCTGTTGGGAGAAGTTGAAACAAGCCGTGTC
CGTCCGGGAGGGAAGCCAGAGCGGGAGCTTGAAGAGAAAGGAAACAGTAAAGAGAAGAAAAGAAGCAAACCCTGCCGTGT
ACTTCGTACCTCCTTGTCAAAAGGACGAAGCTACAGCAAGATGGCCGAATATTCGAAGCGGGGCTACCTAAAGGCAAAAG
TACTCGTAAGCTACGGCTTGCCATGACTGCAGAGCACGCAAGAAGGACGACGTCTGGATTACGCGTGGCCTCTTATCGGC
GCTGGCCCGCGGCCGAGAGGCATCATCCTGCGAGTCCTCGTTGCAGAGGCAAGACGGTCCTCCGGCCAGGCTCAGCACGG
CAAAGCACGGCAACAGACCTCAAACGCTCCCACACGTTCCAACGCTCCAGCAGACCCCGGGCTCGGTCTGGCTGCACGTT
TTGCGGCCGCACGGATCGCGCTCGCCGCACCAGTCCGTCTGGGTGACCGGTGCAGGTGTTTCAGCAACCCCGGGCCCCAA
ACAGCGGCCCCTTGCACGTGACCGCAAGACGACCGTCGCCTACTCCGTACGCAAGCCACGACGGACTGGACTTGCATAAT
GCCGCATCCCTGCGTCGACTCCCACACTAACACAGTCCTCCATTCTTTCTAGCCCCCCTGACTCTGTAGCCCCTCGCAGT
CTGATAGATCTTTTTTTTCCTATCCTGGCCATGCTCTACGTGTCTGAGCGGCGGACTACGCCCGTCTATTCTCGTAGCCG
TTGGTCTTTCTGTGCCTCCACCAAATGGTCTCCTGATGATACTTAAAGCGGTCCCATACCCTCCCGATCTCTCCTTCTTG
CTTCCTCTTCTCTCCAAGAGCACCAACTAGGACCTTTTTTCTCCTTCCTCTTCGCACCCTTCTCTTCGTCCGGTTTTCCC
GTACCGCGGCTACCACCTGATTTTGATCGGCCTCACTTCATCCTAGCAGCAGCAGATCGACATATCGTCCTATCTTTCAG
TTCACTCTTCGTTCTCTTCTTCTGTTTCTTACCTCGAGGCTGTGCCTTTGACTTTCCTTCTCCGCCTTGCATCACCAAAA
TTCCTGTCTGTTCCCATCCCAGTCACGCCACCACCACCATCGCCAAGCCATCATGATGCAGTCCTCGCGCTTCCACGCCA
TCGCCGCCCGCTTCTCGCCCCAGGGCATCCGCACATCCTTCCGCCTGCGATCGGCTTCCGCCTCGTCGACCAGCAGCACC
AGCTCGTTCGGCTCCGCCACCTCGTCCCCCGTCTCCACCGTCAACAGCGTCATCGTTCGGCAGCCTTCCATCGTCAACAT
GGAGGAGGAGCGCCGCATCTTCAGCAGCGGCCTCGCCGTTCTCGAACCGCGCCCCATCGTCTACTGGGGCGGTATGGAGG
AGCGGATGGGCTCGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62