GenePrediction:GLEAN_4615 Details

Name: GLEAN_4615
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1596163..1594831 (- strand)
Length: 1333
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1596163..1595134 (- strand)
Length: 1030
Type: CDS
Source: GLEAN
Position: GCSC_167:1595074..1595001 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_167:1594935..1594831 (- strand)
Length: 105
>GLEAN_4615 class=GenePrediction position=GCSC_167:1596163..1594831 (- strand)
ATGCTGAATCCGAGAACGGGGGCTTTGGCCGCCAGCGCCAGCTGGGCCCGCCTCCGTGTTGCCCGGCGATTTGTCTCGAC
GACAGCGGCAGCACCACCGCCACCCTCACCATCACCATCACCATCACCATCGACGCTTCCACCGGCAGCAGCAGCAGAGC
CGGCGAGCGCAGCGTTTGCGAGCCAGTTTGCGATCCCGGCGCCGACCAAGATCGACCGCGAGTCGGTGCTGATGCGCACG
TACAAGCCGCGGACGCCGGGCGTGCGGCATCTGAAGCGGCCGATCAACGACCACCTCTGGAAAGGGCGGCCGTTCCTGCC
GCTGACATTTCCCAAAAAAGGCCACGGCAAGGGTGGGCGCAACAACACGGGACGCGTGACGGTGCGTCACCGTGGCGGCG
GCGCCAAGCGGCGCATCCGCACGGTGGACTTTGAGCGCTGGGCGCCGGGACCGCAGCTGGTCGAGCGGATCGAGCACGAC
CCCGGCCGGTCAGCACACATTGCGCTGATCACAGACCAGGCCACCGGCCGCAAGTCGTACATTGTGGCGGCCGAGGGCAT
GCGGGCCGGCGACATTGTGCAGAGCTATCGCGCCGGCATCCCGCAGGACCTGCTCGACAGCATGGGTGGCACCATTGATC
CCGGCATTCTGGCTGCCCGGACGGCTCACCGGGGCAATTGCCTGCCGCTGCACATGGTGCCCATCGGCACGGTCGTCTAC
AACGTCGGCTCGCAGCCGAACAAGGGCGCGGTCTTCTGTCGCAGCGCCGGCACGTATGCCGTCGTCATGACCAAGGAGGA
GAGGACATGGGCCAGTGACGGTGAGGCTGACGGGACCGGCGCCCAAAAGGTCGGCCGTTTCGTCCAGGTGCGCCTGCAGA
GCGGCGAGATTCGCCGCGTCAGCAAGGACGCCTGCGTCACCATTGGCGTCGCCAGCAACCCCAACCACCAGTACCGCCAG
CTGGGCAAGGCCGGCCGCAGCCGCTGGCTCAACATTCGGCCCACCGTTCGCGGCGTGGCCATGAATAGAGGTACGTCGAG
CCCTTGCTTTTCCGCGGCCGCTGCCCGAGCTGAACTGACCTGTCTGCAGCCGACCACCCGCACGGTGGTGGCCGTGGTAA
ATCCAAGAGCAACCGCCACCCAACTAGTCCCTGGGGCACGCCGGTACGTGGATGTGTGCCGCAGCCGAAGAGGCAGAATG
CAGAACTGAGAGCTGACACGTGCAACAGGCCAAGGGCGGATACAAGACCCGGCGGACGCACAACATCAATCGCTGGGTGG
TCGTCCCGCGGGTGCGCAATATGGGGAAGCGCAAGAGCAAGGGATCCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62