GenePrediction:GLEAN_4616 Details

Name: GLEAN_4616
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1594227..1592811 (- strand)
Length: 1417
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1594227..1593980 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_167:1593912..1592811 (- strand)
Length: 1102
>GLEAN_4616 class=GenePrediction position=GCSC_167:1594227..1592811 (- strand)
ATGACCGACCAAAGCGCCACTCCGCTCATCTCGTCGACCGGCTTCCAGACGTCTACCAACGACTCTGCATCGCCCGTCAC
CTTTGCAGCCATGGCCCCTCGCCGGTCCTCCGATCGGATCTCGCCCATGGTCGTCGCGGCAGGCATCGTCGACTGGATCA
TCATCGTGGCTGCTGGCGTCGGTGGCTACTATCTGGGCAATCTCACTCCGAATATGCGGCCCTTTCAGCTAGAGGACCCA
GATATCTCGTAGGCCGTTCTCGTCTTCGCTCTCGCCCTCTCTGTTCCGGTGCTCGCTTCTGACCCCGCCTCCCAGCTTCC
CGTACCGCCACCACGAGACCGTCACATCGGGCACTCTCGTTATCGCCACTGTCGCCGTTCCCGTCGCCACTATCCTCGTC
TTCTCCCTGCTCACGACGCCCGGCCTGTCCGTCCCGCCTGGCACACCTGCCAAGCTCGTGTGGCGCCGCAAGCTGTGGGA
GTTTTACGCGTCCCTGCAGTCGTATGCCGTCGGCATGGTCGCCCAGTGGTTCATCATCAATTTCGTCAAGAATCTGTGCG
GCAAGCCGCGACCGGACCTGATCTCCCGCTGCCAGCCTGACCTGGCGCACCTGTCCGAGTATATCGTCGGTGGCATCGCC
AACATCACGTCCAACGGCCAGCTCGTCAGCGCATCCATCTGCAAGAACACCGACTCCTATGTCCTTCACGATGGCTTCCG
CAGCTACCCGTCCGGCCACAGCGGCTCATCCGCCGCTGGTCTCGGCCACCTCGCCCTCTACCTTGCCTATAAGCTCGGCG
TCGTCTTCCCCTATGCCGCCCCGCCTGCATACGACCAGGTCGGCGCGCTCTCGGCCTTCCCTGACCGCGCGGCCGCCCTG
GTGTCCGCTTCGTCGCGGTCGGACCCTTACGAGCTCACCGATCGCCGTCGTGGCCCCGGCAACAGCAGCGGCGAGGCAGG
CCGGTCCGCCAAGAACTACGGTGAGCTGGCACGCGACCAGGCCGTCCATTCGGTCCGGCGCAGCGGCGCAGCTCCGCCTG
TCTATCTCCTCGTCTTCGTCCTCATCCCCCTCGGCGGCTCTTTTTTCATTGCCGCCTCCCGCTGGTTCAATTACCGGCAT
CACGGCTTCGATATCCTGTTTGGCTACTTCATCGGCACCGTCACCAGCATCGTCGCCTTTCGTCTGTACCAGCTGCCCAT
GAGCCGTGGTGCCGGCTGGGCCTGGGGCCCGCGGTCCTCGGACAAGGCTTTCTGGGCTGGCGTTGGCAGCCAAAGCTGGG
CGCTGCCCCGGCAGCCGTGGTCGTTCGCTTCCGGCGACGAAGAGGAAGGCGGCGAATTTGCTAGTCCGGTCGGAGACTAC
CGCCAATACTCGTCGCCTGAACGGTCTAATCTCGAGCCGCGAAGAGGCGCTCCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62