GenePrediction:GLEAN_4617 Details

Name: GLEAN_4617
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1587846..1583351 (- strand)
Length: 4496
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1587846..1587609 (- strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_167:1587543..1587448 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_167:1587356..1586680 (- strand)
Length: 677
Type: CDS
Source: GLEAN
Position: GCSC_167:1586595..1586466 (- strand)
Length: 130
Type: CDS
Source: GLEAN
Position: GCSC_167:1586367..1583351 (- strand)
Length: 3017
>GLEAN_4617 class=GenePrediction position=GCSC_167:1587846..1583351 (- strand)
ATGGCCGCTGAGATCTCTGCAGCCCATACGGCCGACCGCGGCGCCACGCCCGCCACCACCCCCTACAACAACCCGGCACC
TCTGGACCCGACCATTGAGGCGCTCCTCGAGCAGCAGGCCGACATCCACGCCAAGCTTGCTGTCTTGCTCCCCCAGAAAT
ACGGCCCCAACGTGCGCGTCGAGCTGGAGCATCTGCGCCACAAACTGCGCGTTATGCGGGCCTTTGCCGACTCCCATCGT
ACGTCTGTCTATGCCCAGCCTCTGGTGCTCGTTTTCTCTTGCTGACATTTCGCCCGTGAACAGGCTTCTTGGACAGAATC
CCGATATTGTCCGAGATGGAAGAAGCTCGACAGCTTCAATATCAGATTGAATGCATTGAGACTGCATGTCTGGACCACGG
TAAGCTGCGGTGAAAGGAAAACAGAAGAAAGAAAAGAAAGAAAGAAAAAGCCTCGTTGTGCTCGTGATGCTTATGTGCGT
GTCCGTCCAGGCCACGACCTCCACGACCCCCGCGTTATAGACGCTCTGGAATCGGCCCATATGCATGATGCCCCTGCTGG
CTTTGGCGACTGGCTGCGCCGAAATTTTGCCAGCTGCGATGTCGCCATGCGGGCCTGGAAAATAAGAGGCGGTCCTCTTG
CCGAGCCCGGCAACGCGGCCTTCCACTCCTACAAGTGCCCGGACGAGAACTGTCTGCACTACATCTACGGCTTTCTGCAC
CGCGAAGACCGCGACCTGCACACCAGAGCCCACTCCACCCAGGCGAAGCGGGACTCCGGCCTGTCCATGGGAGGCACACC
TCCACCGTCGCTTCCGCCGTCTTCGCTCGCCCGCAGCCAGCAGCTGTCGTCGTCGTCCTTTATCGGCTATCCGTCACCCA
CTCACCCGGTCGGCGGTGGGCTCGGCGGCAGCCTGCAACTGCCACCCCCGCCCATGCCGCAAGGCGGCGAGACCAAGGAG
CACCGTGGCACCTTGCGAGGCTACTCCCTCATCTCCGACTACTCCTCAAGCCACCCGACACGAGACTCGGTGGACTCCGA
GGTAGACCCGTTGCTGCCACCTCTCAAACGCAGCCGCAGGGGACCGTCTCGTCTGGAGTCCATCGGGGAGCTTAGGCTCT
TGCAGGGCGCCGAGCCTTGTCTTCGGTGCAAAGTCCTAAAGCAGCCGGTACGTTCTCGTGGTGGTGGAAGCACCATGCTT
GTTATACCCACCCCCCCTTTATGCCGAACGTGCACTGACAGATGTGCTTAGTGTGACGCAAACGACCCCTGCTCATCGTG
CTACCCAAATGCAGAAGATCCTGCTCAGGGCTCGGACTTCTGGCGGCTTCTTGGCTGCTATCGAGCACCTCTTGACTCGC
TTGTCAACATCCTGGTGCCAGGTAGGAAACCCCTGTCCGTCAGCGATCGTTGTGATCTTGACACAGCCATGGCTCACGCA
GACGACCACTTGCAGCTTTCTTATCCCCTGGTCGTGCAGACACGCCGGCCACGTCGCCTCTTGCTCGGCGCCTCAGCATA
AACGACCGTCTAGAGAGGACGCACCGGACGAGTCCGGATGCGGCTAAGGTTGTCCAGACAAACCTCGATTTTGACGATGA
CTTCTGGTGGACTGAAGACCTGGCCATCATGTCGTCGGCGGATCCGAACCGACCGGGCTCCTTGTCGCAGGAGCGTGCGC
AGAGACCGCCACCGGTTTTGGCGGCGCTTGCTTGCAGCTGGGGCATGAGCGGCACGGCCTACAACTTCTGGCAGCTTCTG
CAGCTGAGCGGCCTCCTGTCGGTCACGAGACATGCCGAGGCGGTGTCGTTTCCGGTGCTGCACCAGGCAAAGCTGCTGCT
GAGAGAGGTGCTCTTCTTCGACCTCCAACAAGCGCGGTCGTCCCTCCTGCCGGAGGCTGCCAGCAGCGCAGACCAGCCAA
GCCTGGCCGACGAGTACGAATGCCATATCCGCCACCGGGCCGTTCGCGGCTGCGTCAGCCAGTTCCTGCAGTCATTTGAA
AAAGCGACGGCACAGAGAGAGGTGGTGGACCCCCGACAATGGCTGTCGCTGTTCTTCTCGCTCTGCATATGCAGCATTAC
GAGGACGATCTTGGCCGACATGGCGTCGCTGCCGCAGCGGCGAGAGTCTGCCACGAGCACAACCGGTACAGCCGGGACTC
TTTCCAGCCCTGCAGCGTCGATCCAGGCCATCTACAAGGCGATGGTGGAGATGCTTGTTTCCGGGCTGCCGGTGATACTT
GACGACCCGACCACTGCGATGGCAGACGACGATCGGGAGCTCTACAACACGGCGTCCATGATCGTCAAATACCACGCTTG
GAACAGCTGGAAGTTGTCGTCGACAAGGGACTTTTTGCTGCTTCTCGGCAGCACTGAACTTCCGGGCGGTGTCTGGCATG
GATTCCTGCGGCAACGGTCAGCCGATGGTTCGGGCAGACTGCTGTCTGAGCAGCCGGCCATGCAGTTGCAGCTGCAGGCT
CAGGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACAAGCACA
AGCACAAGCACAAGCACAAGCACAAACACAGCAAGCTGTCGGTTCGGTCATGCGGCCGCCCCAGGCCGGCGACCAGTGGA
CGACGACGCCTATCCTTCCGTCAGGCGGTGCTGCCCTTGTTGCGTCTCCGCAGAGCATTGGGTCGGATAGCAACGGCGGA
CGCGATCACGCGATGGGCATCGGCAGCCCTTCTTACACACGCAGCAACGGTCACAGCTTCACGTCGCCGACGCCGAAGAT
GCGGGCGGCATATCCGCGGCAGAGCCTCGGACGGGTGTTCTGCACCAAGTGCAGCGAGTATCCGGAAGGCTTTCGCGGCG
AACACGAGCTGCGGCGCCACGTCGACGCCAAGCACGCGGCTCTGGTCAAGCGATGGATCTGTGTGGAGCCAATGGGCCAG
CCGGCTCCCAGTTCTCCGCGGCCAGCAGTTCCGCTGACAAAGTGCAAGGCATGTCTTGCAAAGAAGCGGTACGGGGCGTA
CTACAACGCGGCAGCACATCTGCGGCGGGCTCACTTCCCGTACAAGGGAACAAAGATCAGCGGAGAATGGCCGCCGATGA
CGGTGCTGAAGGACTGGATGCAGGAGGTGGTGCAGTCGTTTGACTCGCCGGAGGACCCGATGTCGTCGGACGGCGACGAA
TACGGTGACTACAAGACGCGAGACTACATGGAGCCGCCACGGGGCCACCATTCGCCTCCGTCAGAGACACCGCACTACAC
GGCAGCGCCGACAAGAGACAGGCCGTCGCCAGCGCTGCCACAACCGACACAGCTGATGCACATACAGCCGTCGCTGCAGC
CGTTGCTGGGACCGACGATGGCCGCACCGAACGCGGTTCCGGGGCCGGGGTCGGGGCCGGCGGCGATGCACATGGCTCCG
ATGCATGTGCCTCCGCTGCAGATACCATCTGTTCAGCAGCAGCAGCAGCAGCCCCTGCCGCGACCGCCTCAGCATCGCCG
GTCGCTTGGTACTCCGATGGCAGGGGAGCTACCTCCGGCCAGCGGGTCCCATCACCACGGGCACCAGAGCAGCCCAGGAC
AGAAGGTGATGCCTCAGGCAGCAGCAGTAGCAATAGCAAGCGTGAAGTCGGAAGAGGGCCACCCACCGAACCGGAATCGC
TGCCCGCATCCAGAGTGTGGGCGAGTGTTTAAGGACCTCAACGCGCACATGCTGACACACATGGAGGAGCGGCCGGAGAA
GTGTCCGATCGAGACGTGCGAGTACCACACCAAGGGATTTGCGCGCAAGTATGACAAGAACCGGCACGCGCTGACGCACT
ACAAGGGCACGATGGTGTGTCCGTTCTGCCACGGGGTGTACGAGAAGGCATTTAACCGAGCAGACGTGTTCAAGCGGCAC
CTGACAGCAGTTCACAACGTGGAGCAGACGCCGCCCAACAGCCGGAAGATGGCGCTGGGGTCTGGGGCTGCTCGACACGG
GGCGAACGCGACAGAAGGGCCGGACGGCAGGGCGCCAGCCAAGTGCTCGATCTGCCAGAGCCAGTTTTTGACGGCACAGG
AGTTTTACGAGCATCTGGACGACTGTGTGCTCAACGTGATAGTGCCATCGACGCCACGGAGTGCCGGAGCGGTCAGCACG
GCCGGGACGATTACGAGCTTGAGCTCTGGCAGCACGGCAGCAAGCAGCGCAGTGTCGTCTTCCGTGGGCACAGGATCCAC
ATCGACAAAAAACAAGCCGGGTGGCAGTGGCGAGGAGACGACGTTGACGAAGACACCGACAACGGCAAACACAGAGCGTG
GCGACCGGCCAGCGGAAGCGCAGCTGGAGGGAACGATCAAGACGGAGCCACCGCTGCGACACCTGCTGCCGGGACTGCCG
TCAGAGCAGGAGAGCAGTTACGGGCGAGGACGGAGACCCGAGCAGCAACGATACGAACAAAGCGAGGGATATTATGCAGG
CGGGATTCAGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62