GenePrediction:GLEAN_4618 Details

Name: GLEAN_4618
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1581016..1579316 (- strand)
Length: 1701
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1581016..1579403 (- strand)
Length: 1614
Type: CDS
Source: GLEAN
Position: GCSC_167:1579342..1579316 (- strand)
Length: 27
>GLEAN_4618 class=GenePrediction position=GCSC_167:1581016..1579316 (- strand)
ATGAACGAGTTTCTCGCCCAGCCGCGACCGCGCCGGCCGCACCACGCCGACACGCTCGACCTGCCGGAGCCGACGGTGGC
CTACCCGACGACGGCCACGACCAGCGGCCGCTCGACACCGGTGCCAGCCGACGCGCCGCCATCCGTGCAGTCCCTCTCGG
TCGCCCGCAAACAAGTCCGCGCAGAACAGCGGCAGCGCATCTTTCCCACGATCGAGTTCGCCAGCCGGGTGTCGCACTTT
GACCCCAGCAGCGACCATCGCGACTTTCGCGGCTTCTTCAACCTCTTCTGGATCGGCCTCGCCATCATGGCCTTCACCAG
CATGCTACGCAACATCAAGGACACCGGCTATCCACTGCGTGTCCAGATTTGGAGCCTCTTCACCCGGAAGCTCTCACACC
TCGCCCTCGCCGATCTCGTCATGGTCACCTCCACTGCCGTCAGCCTGCCGCTGCAGCGCCTTCTCCGCACCACCGCCGCC
CGTCCTGGCGGCCTCGCCTGGGCTAAAGGCGGAAAGGCCCTCCAGAACGTCTATCAGGCCGTCTGGCTGCTCGTCTGGAT
CGTCCTCCCCTTCGCCCTCGACTGGCCCTGGACTGCCCAGGTCTTTCTCCTGCTGCACGCCATGGTCCTGCTCATGAAGA
TGCATTCTTACGCCTCTTACAACGGCCACCTCGCCGAGACTGAGCGCCGTCTTCGCGCTCTCGATCATCCCGACACCGCT
TCCAAGGCCCCGGCCTATCTATATCCCAATGCCGACCACCCTGACGGTGCCCTCGTCTCGCCCACTCGCCTTCACCACTC
GCCCGCCGACGACTGCCCCGATCATGCTGCTGCCGATGCTGACATCGACGACGCCGACCTCTCGCTGCTGCGCCGTAGCC
TCGCCCGCGAGCTCACCAGTCCTCTCGGCAATGTCACCTTTCCCGCCAATCTGACTTGGCCAAACTACGTCGATTACATC
TTCTGCCCGACCCTCTGCTACGAGCTCGAGTATCCGCGCACCGACAAAATCCGCTGGTCCGTCCTCGCCTCCAAGATCGT
CGCCGTCTTCGGCTGCATCTTCCTCCTCACCGTCACCTCCGAGGAGTTTATTCTCCCCGTCCTCGTCGAGGCCAGTGCCC
GTCTCGAGCCCGGCCCCCCGCTCTCCGAATCCGTCCTCATCCTCGCCGAGTCCATCTCCTGGCTGCTCTTTCCCTTCATG
ATGACCTTTCTGCTCGTCTTCCTCGTCATCTTCGAATACGTCCTCGGTGCCCTCGCTGAGCTCACCCGCTTCGCTGACCG
CCACTTTTACAGCGACTGGTGGAACAGCACCGACTGGATGGAGTTCAGTCGCGAGTGGAATATCCCCGTCTACAGCTTCC
TCCGCCGCCACGTCTACAGCGCCAGCCGCCCCCACATCGGCCGCACCTTTGCCACCATCATCACCTTCCTCATCAGTGCC
ATCGGCCACGAAATCGTCCTGGCTTGCATCACCCGCAAGCTCCGTGGCTACGGCTTCATCTGCCAGATGTCCCAATTGCC
CATTGTCGCTTTGCAGCATTCTCCCTGGGTCCGCGGCAAGAACACCCTCAACAACGTCTGCTTCTGGTGCTCCATGATCC
TCGGCCTGAGCTTGGTATGTCGCTCGCTCTCCCTGTCCCGGTACGCCACTGCCTGCTAACCCGGCCTGCCGCAGATCTGT
TCTCTCTATGTTCTCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62