GenePrediction:GLEAN_4619 Details

Name: GLEAN_4619
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1572565..1570768 (- strand)
Length: 1798
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1572565..1572449 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_167:1572336..1570768 (- strand)
Length: 1569
>GLEAN_4619 class=GenePrediction position=GCSC_167:1572565..1570768 (- strand)
ATGGCAGTAGTCTCTTCTGCCCCGATTACGACAGCCGCCAACGCTACGGCACTCACGCCCCCTCATAGTTCTCACGGCAA
CGAGTACACATGGGATGCATCAAGCCAACATGTAGATGTAAGTGACATGTCGATCACGAACCGCTGGGCTCCCACAGCAG
GTGGAGACAATAGGACATTCGGTCAACGGAGAAAATTGCTGCCTGACTAACTCTGTGTCTCCCCCACAGAGCTCCATGTT
CGCTCCAAACGGAGGTACTTACTATGCTTCGACCAACGACCTGACCGCGTACGACGCCAGCGAGAAAGGAGTTTTTGGAG
GCGAACCGCTACTCCGACAGCAGACGGCACCGTCATCCACGCACCTATCTGAAAGTGTGCCGCTCGGTGCAGCTCGGGAC
GGTCAGAAAGGCCTGGACGATAGCCCGATGGAAAGACCCAAAATCACGCAAACTGCTTCTGTCAACGATGTGAGCAAAAA
GGCCGCCACCAAAGAGCAACACAGCAGCGACCCCGACGACGTGAGCTCCAAGTGGATTCATCGAGACAAGCTGGCCAGGA
TCGAGAGCGAGGAGCTTCAGGCGGCAGGTATCATCCTTCCCAAGTCTCGGGCACGGAGCAGGCCGCGACGGGACGCGAGC
GTAGACAAAGCAAACGGTCACCGGTCGACCGGGCCGGAAACGGATATTCCTATGGAATCAAGGTCACGACGGAGCTCGGT
CTTTAATGAGCTCAAGCCCCACGATGCAAGTCGTCCCTCTTGGGATCTTCGCCGACCGGACGAAATCGACGACGCAGCTT
ACTTTGTTCCGACTAATGGCACCAAGGGTCTTTCGCGAATTCCCGTTGCAAAGCAGAGCCCAGCCCCCATCCCTCTGGAA
CATATCGAGCGGGACTCCATGCTGGCCCGAAAGCGTGGCAACAGCATTGGTGCCGAGGAAAGCATTGGTCTAAAGTCTAG
GTCCCGAAGCAACAGCATCGGAAGAGCCCTTGACGGAGGCACAGGATCGAGTACAGAACCACCGTCACAACGCAACGCAT
CACGCTCCGTGTCCGAAGCATCTCCGAAGAAGCTAGCGACCAACGGCAGTGCCAACGCGGGAGGCGGACGAAAGCCGACG
ACATCCAAGACAAACTCGACCAGCCGCCCTAAGACTCGAAATGGGATAGGCAAAGATACCAATGGCAGCGCCGCCGGAGG
TGCAGCACGCCCGACCACGCGCTCTGGTGAACGAGAACTGTCGGGTGCCGCTCACAAGCGTCCCGAGGGCGAGCCGCCCT
GGATGATCAATGCCTACCGGCCAGACCCGCGGCTTCCACCTGACCAACAGCTGCTTCCTACCGTGGCGAGGAGGCTGCAG
CAGGAGAAGTGGGAGCGTGAGGGCAAGTTTGGAAACATATACGACAAGGAGTTCCGGCCGCTGACGGAGAATGGTTTCCT
CACACCGCCAGAGCCATCAAACAGCGCGTCAGCAGCAGCAGAGACATCTACAGCCACCGGAGAAGCCACCGGAGAAGTCA
CCGGAGAGACTACTGGAGAGGCCACTGGAGAGGCAGGCCATTGGCCGCTCAAAATCGAGGCGAAGAACCCGGCATCGCCA
ATAGGACGGAGCGGATCGTATTCCACCATTCCCAAGATCCAAGACCAGCCAGGCCTCAGCCCTCTTCCAAGTCCACTTGG
GCCCACAACGCACATATCGGCATCAGGGCCCAAGCCAGCGCAGACGGCGTCAGCAGCTGCTGCCACGCAAGACGAAGACG
ATGCGAAGGGTGGTTGTGGCTGCTGTGTCGTCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62