GenePrediction:GLEAN_4625 Details

Name: GLEAN_4625
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1506407..1499872 (- strand)
Length: 6536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1506407..1506336 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_167:1506135..1502488 (- strand)
Length: 3648
Type: CDS
Source: GLEAN
Position: GCSC_167:1502421..1499872 (- strand)
Length: 2550
>GLEAN_4625 class=GenePrediction position=GCSC_167:1506407..1499872 (- strand)
ATGCCATTTGCTTCTGTCAGACTGGACGTGGACGCGATGAACGCATTTGTCACATCGCGGCCACAGCGTCTTGTTTCTCC
AGAAAGTTGCTGACGGCCATTGCCGTTCTTTGTCGATCATAACCTTCCTACAAACCTTAATATGGATTGCCCCAATGATT
GCCATCACCTTCACACTATCCTCTGCAATGCCACATTCCATAGCTGGCACATGCAGCCTAGCAAAAGGAAGAATGGAATG
TAGCTAACCCTACCTGTTCTTTGTATGTTCAGACCATGACTTCCACCAAAGAGGCGTCCGACGACGGTGGCTCCACATCC
GATTCCTCTGTTTCAACCACGAGGCCTGCTCCAACCACGTCTGCGGCGAAGCCAGATGCCGACAATGCCGCGCCTACGTC
AACAGATACGCCAACGGCTACGGAAACGGCCGCGGAAACGGCCACGGCATCAGCTGCACCAGAGGATACTCCGGTGACAC
CAACTCAGAAGGCATCTGCTGGTCAGACGCCTAAGAGCGCGCCAGCAGCGACGGGGTCCGTTGGAGCCAGGCAACGCCGT
CTGTCACAACCGGCACGAGTTCAGCCTACCCTGCTCACGGACTTCCTTTTGGGCCGCCAGTCACAAGCTCGTGTTGCTGC
CAGCCGGAGAAAAACACTAGATGCCGCCGCTGTTAAGGCGGAATTGCGGACCGCCATGCGTCAGTCTTCCGTCCGCAGGA
TACAACAGCCAGGTGGCGTCCGGGACCGTGTCAAAAACTGGCAGAAGAAAACTGCCGTTGCATTGGTGGAAGGCGGAAAT
CCTGAGATAGATCCCAGTGAACCAACCGAGATTGCTTTCAAAGAAGAGGAACGCAGCGTTACCGAGTCTGATCGCGTCCG
TATCAAAGCTCGCAAAAAGGAAAAACAACCTCGCGCGCCTGATGACAAGAAGATAGCACCCGAGGAAGATGATGAGGATG
ATTGGGACGACGACCCAGAGGATGCTGCCAAGCCCATTGAACCTCTACAACCCCCAAAGGCGAGGCCGGGCCCGCGCGGC
CGTCCCAAAGTTACAAGTCCTCCAAAGCGAAGAATCGTTAGCGACGACAACTGGATGAAACGCAAAAAAAGAACCAGCCC
CTCTCCCAAATTCACCGGCGCAAGGACGAAGCCAGACCTCGGCCGTCCAGTCCCTATACCAAAGGACTTTCTTCAGCGCA
CCGCCCAGAACCCGACTGTCAAGAACAAAATCAAGGACTGGGCCACAAGGGTGGAGATTCCCGAGACACCACCGGCCAAA
TACACCCGGAACAAGGAGAGGAGAGTCTCTCGGGAAAAGAGCAATAGGCAATCCTCGCAAGATACAGCTAGACCTTCAAG
CTCCCGCAGTGCTCCTGAAGACGGCTTTCGTGCCCGCCCCGTTCGGTCGACAAGATCCGCTGAGGTCAGGCAGGCGCAGA
TTGAACGCGAGGCGAGACGACGGTCTGGGCCGAAAAAGATAGTCGTCGACGACGGCATTCGGGTGCGGCCTCTGAAGCCC
TCGAGTCCTGATGACGGAATCAAAGTCCGGCCCCTGAAGCCATCGAGTCCCGATGACGGGATCCGAGTACGGCCCTTAAA
AACCTCGCTTCCAAATGACGGCATCAGAGTCCGACCACTGGAACTACGAAACAAGGGTCCTGCGCCCCGAACCCCATCGG
TCAAGACCTCCTCTCCAAGTCAGTCTGTTGCCCCAACAGAGTCAACCTACACTGCACGAAGTGCACCAGCACGAAGCACG
CGCCTTGGCGGGTCGTCAACCGATAGTCTGCACCGTTTCGAAAAGAAGAAGAACAGCACGCCGGAGAAGGGCACAAAGCT
ACGTGAGAGTCGCTCGTATGAAGATCAAAGCAGGCGTGTCGATGAAAACAAGAGGCCAGGTAGTCAAACACCCACGCGGA
TACCACACCCAAAAAGAAGTCCCTCGATACGAAAGGCGCAGCCAAAAAGCAAACCAAGGCGTAGTCCTAGTCCTGCGGAG
ACTCGCACAGAAACAGCTACGACGCTTACTGAATCGTGGCAGGACCACGAAGAGTCTGTCAACTCTCAATCCCCGTCAAA
TGTTTCACTGGGTGAATTATCCGAGCCGTCAACGTTGCCTTCAAAGACCTTGGCCGATATCCCGGTGGGCCTCTCGGCTT
TTAGCGAGCTTGATCTACCCGTTCGTGGGGAAGGTGGAAGATCACGACCAAGCAATGCCCGGGGAACGAGCTTCAAGGGT
GTCCCGCAAGTACTGAAAAAGGTGGTCAGCGAGGGAAAGAAAATGATCCACGAGGTATACGAGAAGCCAGAGCCACCTCG
TGCGGCACCAAACCGGCCTGTCCGGATCGAGAACTGGCTGGAGAACACCGTGGATCCTTTTGTCGATGCGTTACCGGCGC
CGAAGGTCTCGCCCATCCAGAAGCAGCAGTCGGTGGAAGACGAGTGGAAGATGGATGCGCGGAAGCGATCGATCCCAGAG
CCACGGACGCGCAGTCGCGAGCGATCCCCTTCGATGCCCAACAACATACTGCGTGACAACGGGGACCATGGGCGAACAAG
CTCGACAAAAATGAAAGACATGGAGAAGAAGGCACCGGCGCCAGTGCCCAAGAAAGAACGTGTGGTCGAGGAGCCTATGA
TGACAGCCGCGATACCAGCAGCCGCTACGCTGGATGCACGGTCTAGTAGTCCTGGTCTGCGACGGAGCAGAGCCACACGA
GGCTCGGCATCTTCGGTGAGGGCCACAAGTGCAAAGAAGCCCACGCGCGATCTACGTCGTGACACACTGCGTGGTGAAAG
TGGAGGACATGCGGCGCCAAGTTCGAACGGCAGCCGCGGATCTTCTAGCCGCGGGCGAGACCATGATGCAGAGTCAGATC
GATACAGGGACGACCGTAGCTCTGACAGCTACAGTACGTATAAATCGGGGTCAGAACGACGAGACCACCACCGGAAGATT
TCTGCTGGCTCGGGCAAGAGCAGCGCTTTGCTATCATCCTCATCCGCAGACGCATCCAGCATTGCCGAGAGTGAGCTCAG
CAGCAGCTATCTCGGTTCGGACATGCATTACTCGGACTATGTGCGACGGCCGCCACCTCCAACGCATGGGGACCATGAGC
TGTCAACGATCCTTTCGGAAGAGTCGTCTGGCTCCCGGCCGTCGGACACCATGTCTACGATCTCGGAGTCCACCGTTACC
CAAACAACGGTCACGAAGATGGCCGGCGACTTTTCAATAGCGGGAAGCCAGCGGTCGTCGACAGGTCTGAAGCGACGGCT
GACGAAGCATTCCGATCTGGTGTCGGTGCTGTCTCTGCCGGACGACGCGCGGCGGCTTTCGCGGGCAAAGAGCATCAAGC
GGGCGCGCAGTCTGCATCGGAGGACGAGCAAGCTGGACAATGCAACGTTAAGTGACCTCCTGCTGGAGTTTGGAGAAGAT
GACGATCTCTACAGCAGAGAGCTGAAGACTCTGGTTGACGGTGTCATCCCCGTTCTTTTGACGCAGTTTGTCCACGAAAG
AGACCCCCAGCGGTCAGCGCAGATCTTCGGAGCTGGAGCAGATGCCCACAGGATCAACATGATGTCGAAAGCCGTGGTCG
ACATGGGCGTCGTCCTCGAGGAGCTGAGAACTCTGCACAAGCTTGTGCCGCTTCACGACGCGCAGCGCATGATCCAATGG
ATGGAGACGGCCTTTTCCGTGTACGAGGACTATCTGGATGCTTGGCGTCTGGGCTTCCAAGGCATAATTGTCAACCTGGC
GCCGGCGGCGGGAAGGCAAGACGACAACGACTCGCTCCTGAACGCCATGGACCGAAATGAAGACGGCGATGTGCTGGACG
TGAACGGAGAGCGGGTTGACGTGGCGTACCTGCTGAAGCGACCGCTTCTGCGGATCAGATGGATGCTGAAGTTTGCAAAG
GTAAGGCGGACGAGAGATGCCGGGTGTACGAGGAAGCTCTGATTTCTAACGGTTCGGCGAATATAGGGAGTCAAGATCAT
CCTGGGCGCGGGGCTGGCGGGCGACATCGTGACGCAGCTGGAAGCTCTGCACGAGAAGGCGCGGCGACGACATCGCGAGG
AGACGGCTCGCAAGACGGACGAGGATGCGATAGCAACGGACACGACTCGAGCGCGCAGTCTCCGCAACCTGGCCGCTCTG
GATCACGTACACATTGACCGAGGACGGCAGGTCAACGCCAAGGACTGGTTCGACCTGGACCTGTCGCACTCCAACGGCCA
GCGGCTTGAGTGCCAGGTCGAGCTGATCTTCCGGGACGTGCCGGGCGACCCGTCGGACGCGGGCGACATTCTCATCCGAG
AAGCAGGGGCCGACGGCCAGTCATGGCTACTGTTCCCGCCCATCTCGCTGCCGTGCATATCAGCCCGCCGGGGCGAGGAC
GAGCAGTCACTGGTCGTCATGATCCGCGATGTCTACCATGGCCATGAATGGTACGAGCTCATGACACTTTATGCGGACCT
TGACGATGCAGTAGACGACTGGTTGGAGATCATGGGCACCAGTCCGGTGCCACCGATGCTCTCCGACATGAGCGTGGCGG
AGGAGATGCCAAGAGCAGCTGAGGAGGCCGACATTCCGCTGGGCGAACGCAGGTTCCAAGAGGCCGGCCACGAGAGTCCT
ACGGGGCCGAAGACACTATCCCGCTACCACTCGCGCCAGAGTTCCAGCTCGCGGACGCCATCGACACCGCCGTCGCCGTC
GTCGCCTAGGTCCGTTTCCGATGCCGAGAAGACGCCGACACAGTCCAGCGCACGTCTGGCATCTCCACCACAGTCACAGG
GGCGACGGGCACTGCCGGTGATTCCGGAGAAGCCGACGAGCCACCCGCTCAACGAGGACATGAGGCCGGATCCGTCGAAG
CTCAAGAGCTCTTCCTCCAAGAGGACAATTGCGGACGAGGACGGGGCACCTCCTCTGCCACCAGCCCACCGGTCGGTTGG
ACCGAAAGCGGCGCCGATACTGGCACCGCCGAGCAGCAAGAAGTCGCAGGCGCCCTGGATGCGGCGTCGCACGTCGTCGC
CGTTGAAGCACGAATACCATCCGTCAGACCACTCGTCCGAGAGCGACTCGACGTCGGAAGGATCCGAGACGGAGTCGGAG
TCGTCGATCGAGGACGACCTGTACGAAGACGACATCCCAGACACGCTGCCGGGCATTAGCATCAAACAGGCGGAGCCGTT
CTCGGCAGAAGCCATGGCATCGGAACGAGAAGACAGCATTGCCCCGTCGCATTCCGCCTCACAGATAGGACTGCCGGGTC
TGCGGACGTCGCGTGTATCCGAGCACACGCTGCAGTTCACGGCGGAGATCTCGTACTGGTCAAACAAGAAGGGGGCGTGG
AAAGGCCTAAAGGACCCGGTCAGCACAATCGTCATCACGCCAGGGCTGATCGAGGCATTTGCGCCGGGAGCCATGGTGGC
AGATGCACGGCGCAGTCCCGGACGGACTGAGTCGTCGGAGGTGGAAATCAGTGCAGAGGTGCCACGGCCGCTGATTGCGC
TGGACCTGACGCCGCTGGTGATGATCCGGCAGAGCACGCTGATTGACCTTGAGATCCGGTCGCCGGTCAGGGCGTATGCC
AAGTACAGCAACCTAGACACGAGCATCTTCCGGTTCCGGGCGTCGTCTCCGGCCGAGCTGGCCAACCTGTACAAGGCGGT
GCACCAGTCGCGGATGAACAACGCCAAGTACAAGGCGCTGGAGGAGGAGGCGCGATTCGAGTCGTTTGGCCAGCCGCAGG
AGCGAGTGGCCGGCGGCGACGACAACAGCAGCATGCGCCGACGGGGCGGATGGTTCGGGCGCAAGAACAGCTACCGCGCA
TCGACACGGGCACCGTCACAGGTGCAGTCGCAGTCGCAGTCACAGGGCAGCTCGTCAACGCTGTCGGCAACGAGCTTTTT
GCGGCGACTGACGGGACACGTCAACAAATCGTTCAACATTGATCGCTCGTCGGTAGACAAGTCAGGGCGACCAGGCAGCG
GCGGCATGAGCTTCTACACGTCGTCCGGGGCGTCGTCAGCGGGCAGCGGCATACACACGATGCCGCGGTCGCCTTCGGTC
AGCCTGGCAGACGGCAGCATCCGCGGCGTGCAGGCGCTGGGAACGACAAACATCAAGATGCGCTGCCACCTGCAGATCTC
GGGCCAGAAGTGGGAGGACCGGGGCAACTGCACGCTGACAATTGCGCGGCCACCACCGGGCGCGCGACAGGAGCTGACAA
TCTACCACGGGCTGGAGAAGCGGGTGCTGGTGCTGTCGATTCCGCGCAAGGAAAACATCCAACCGCTGATTGTGCTGGAT
GTCGTTGTGGGCAGTGCGTGCTTCACGAGGCTGGCGGCTCGCGGCATTGTGCTCAACGTGTGGGAGGAGATGCGCGACGA
GCAGAACCGTGTCGGCCATGTGTCTGCGGCTGGCGCCATCAGCGGCCGTGTGCGCAAGTGGTGCTTCCAGTTTTCGACGG
CGGCAGTGGCCAGCTGGGTCTACGGCCTTGTGGCCTCGGAGGTGGAGATTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62