GenePrediction:GLEAN_4626 Details

Name: GLEAN_4626
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1499288..1498264 (- strand)
Length: 1025
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1499288..1499150 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_167:1499063..1498264 (- strand)
Length: 800
>GLEAN_4626 class=GenePrediction position=GCSC_167:1499288..1498264 (- strand)
ATGGCCGACTATTCCTCTCTCAAGGTGCCCGAGCTGAAGAAGCTGCTGAGTGAGCGCGGCCTGACGGTGAACGGCAACAA
GGCCGACCTGATTGCGCGCCTGCAGGAGAACGATGCGGCGAGCAAGGGCGGTGCCAAAGGTTCGTTTTCGTCGAGCTTTT
GTCGAGTTGGGGGCAAGAGTGTTTGTTTGGTGAAACCTGCGTTTATCTGCTGACGACCGCTGCAGCTGCAGCCGAAGACG
AGATCGACTGGGACGACGAGCAGCCGACGGCCAAGGTGCCAGCGGCTGCGGCTGCCGCTGTTGAGGCCAAGGCCAAGGCC
GAGACGACGACGATGACGACAGCATCAGAGCCGACGACAGCGGCGGCAGCGGCTGTTGTCGACACGGCCGAGGAAGCGGT
GCCGGCTGCTGCTGTTGTTGCGAGCGACGACAAGGTGGGCGGTGAAGTCGGTGAAGTCGGTGAGGCCGCCGATGCAGTCG
ATGCAGGCGATGCAGAAGATACGACTGCCTCTGTTTCTGCTCCTGCAGCAGCCGAGTCCGAGGTCGTTCCCGGCCTGTCG
CAGCACCTTGCCGCCACCGACGCGGACGAGGAGGCCCGGCGGCGTGCCGCGCGTGCCAAGCGCTTCGGCATCGTCGACGA
CGCGGACGTGGCCAAGAAGACGGAGCGTGCGGCTCGATTTGGCATCGATCAGGCCGCCGTCAAGGGCCTCGATGCCGCTC
TGCCGGACCGCCCGCGCAAGCGCGGCGCCGACGGCATCGATGGACCGGGCGGCGCGGCCACGACGGCCAACGGCACAGCC
GCCACCAACAATGGAAGGGGCAACAAGCGTGTGATGCCGGATCGCCGCAGTGGAGCCGGCCGCGATGGCCGTGCGGGCGG
GCGTGGTGGCCGTGGTGGCAGCGCTGCTCGCGGACACGGAAACGGAAACGGCAGCTTCGGCGGCCAGCCAAAGAAGAGAG
CCGTCTTGGATGACCCGGTCGAACGGAAGAAGGCCGAGGAACGGGCAAAGCGGTTCGCTTCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62