GenePrediction:GLEAN_4627 Details

Name: GLEAN_4627
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1490699..1489647 (- strand)
Length: 1053
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1490699..1490449 (- strand)
Length: 251
Type: CDS
Source: GLEAN
Position: GCSC_167:1490217..1489884 (- strand)
Length: 334
Type: CDS
Source: GLEAN
Position: GCSC_167:1489823..1489647 (- strand)
Length: 177
>GLEAN_4627 class=GenePrediction position=GCSC_167:1490699..1489647 (- strand)
ATGCCGTTATCGTTTATCGAGTGCGCCCTTCTTCCCCGCCCGCAGAGACTGCGCCCTGGCGTCTGCATACGGCCATGTCC
TATGAGAGGCGGAGGCCCGGACTCGTCCCTGCCATTGGACAGCTCCGAGGCGGGACACGTCCAATGGCGCCTTCCCGCAC
AGGACGTGGTGGAGACCCTCCATGCGACGCAGGGCAGGTGTGACCGACGCCAGGAGCAACTGCAATGGCAGCTGCAATGG
CAGCAGGAGCTGTCCGTACAGACGCGACAGCGACCTCTGGCTTGTGCTAGTGGCGGGTAGTTAGCGGAGCACAAGCTTGC
CGTGGCAGCTTGCACAGCGGTCGTTGAAGCTCATACGTCGTAAGATGCTGGTCATAGGCGACACGGGACGACGCTAGGCC
TGGGCCCAGCGCCAGCAAGGGCTAGGCCAGAAGGCTACGCTCCCTAAACATCCGCGTCGCACCTGCTGGTGTGCCAGCAC
AGCAGCATCTCAGCTGGCGCTGGCCCCCTTCCAGAAGGCGAGGCCAAGCTTCGGCTGTCCCAGCCGGCAGCCCAATCTTC
AGCGTGTGTCGCCTGCAGGCTTCTCCGACGTTACAATGCGTGTCTCATCCTCCCACAGAGGGTGGTTCGGGGCGGCGACG
CTACCACGTACTATGTTAGGGCGACATACGGAGTACTTAGATTGAGGATTACAGGGTTCAGCGAGATTACATACACAATC
GCCGTTGGCTCGCTGACCAACGCGCCCGCTAGCAGAAGACCGCTAACAGCCGGTAGCGAGGAAAGGGCCGACGCCATGGT
TGTGTTTTATTGGCGTGTAAGAAGGACCACGGGGTTTATATAAAGAAACGGCTATCCGAACCCCTTCACCAAATAGGCCG
GCTTGTCGGTGGTGCCCGGAGTCGCAGATGAGAGCCATACGAGGATAGAGCTCCGAGGCTTCATCTTCACAATTAGCTCC
ACCACAGAGAGCCCACCTCTGCCGCTCCGCTGTGATTCGCTGATCCGCACAGGGGTCCGATGGGACGACGAGGTGGCCAA
GCCGCAATGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62