GenePrediction:GLEAN_4629 Details

Name: GLEAN_4629
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1450965..1444719 (- strand)
Length: 6247
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1450965..1446920 (- strand)
Length: 4046
Type: CDS
Source: GLEAN
Position: GCSC_167:1446774..1446240 (- strand)
Length: 535
Type: CDS
Source: GLEAN
Position: GCSC_167:1446170..1445671 (- strand)
Length: 500
Type: CDS
Source: GLEAN
Position: GCSC_167:1444839..1444719 (- strand)
Length: 121
>GLEAN_4629 class=GenePrediction position=GCSC_167:1450965..1444719 (- strand)
ATGCAGCAGCCACTGGTGCAGATGTCCCCTCAGATGGGGCATTCGCCCCTCTATTTTGACAACTTTCACCATGTCCACCT
CAGGCCCGAATATATCTTCGCTCTGCAGCAGCAGCAACTCCAGCAGCAGGCCCAACACCAGTATTATCTCTCCCAAAGTC
GATCTGTGAGGCCACAATCTTTTCATCAGGCCGCTGCGGTGGCTGCTCCACAACGAACCGTTGCCTTTCCGATTCGCAAT
TCGCAATCGACGGCTGTTTCGCTTGGCAGCCAGGTTCCGCATTCGCAACTGCAGCACCATCTACAAAACAACGGTCGACC
CGTCCCAAATCTAGCCCCTGGCGCTGGCGGCGGTGCAAACGGGGCCGCATTTCCTTACATCAATAGCGGGCGTAGCCTTG
CCGAACGATTTCAGGAACACCAACTACGCCGGAAAACGCCAAATGGAACCATCGATGCCGGGTACGATGGATCACCGTCC
AGCCTGGCGACGGGCCCGCCACCTTTCAAGCAGATGGCCTTGTCGGTGCCCTCGGTCATTTTTCCCACCGCAGTGGTCCA
ACAAAATGGTCCTGTTCGAAGGATGCAGATGCAGCAGCTCGTCGCTGCCACCGCCACCACCACCGGCCTGCCCTCCAGAT
CAAACGTTGTCGCGGGACAGCCTTTGGTACAGACCGACGTGTGGCCATATCAACTGACAAGTGTGAGGGCTGCAACTTCT
GCCGCTGCCGCTGCTTCTGCAGCACGTTCTGGCTTTGGGGCACCGTGGATGGGCCCAGAAACCATCAACCCGGAAGCTGC
AAAAGTAGCGGCTACCTTAAATAATGTCCCCAATATGGCAGCATGTCAGGGAGCTCTACTACAAGCGTCTACGTTTTTCG
ATGAGCCGAGAGGCCACGACAGTAGCAACATGTTTCCCCAGCCTGTCTTTTCACCATCTTATCAAGCATCACCTGGACCG
ACAGCCTTCAATCCAACCAGCTTCAATCCCCAGCCCATTTGGCCCGACTCTGCATTGTTGCAGAGTTACCAGACGCATGG
GTTCCCGCTCACCAAACTTGTCAATGTCGACAATAGCCTTAGCCCAATACCGCAGATTGGGGTATGCAATGCGAACTACA
GGCAGACTGCTCAGGCTACCCAGCCGTTGTTTCCTCTCGCTGCGCCTAATCTCAACATGGCACCGTCTATCACGGCTTCC
AGCCAACCGAACATGTTTAGCTACCACTCAGCACAAATCTCCAGCTATAATACTGGCCAGTTTCACCAAGGCGTTCAAAG
GCAAGCTCCGGGTCGGAGCCAAAGTCAGCAACCTATGAACATGGACAGCTCGGCAATGCTACATTCTCCGATACAAGCAT
TGCAAATGCTGTCTATGGGACCGCCTTCCTCTGCTCTTCCAGCCGCTGTAAACATTTCCGCAACTGGCGAGGGTCTCGTG
CAGTTTAAAGAACGTGTGTTAGCGCAAGGAGAGAAGACATACGCCGAACTCTTAGTGCACCTAACCCATACCAAGAAATC
ACTCAACGGCAGGCCTCTCCCAAGTCTACGACCGCCGATGAAGACATCTATGCACTCAAAGTCCTCGCAGCGACAACAGC
AACAGCAGGCATTTTCTGCGTGTGGCCTCGTGTCTGAACCGCACATGGCCGCAGTTCAGATGTCCCATGGAAGGCAATCA
CTTCTCGACCATCGTCACGGTACAGCTCATTATCCGTCAGCGATAGTTAACGATGCCGGGATTTACCAACCGTCTGTAGC
CAATATCCACGGCGCCCAAGCAGCAGTCCAGAACATGTTTTTTCCACATCCTCCTCTCATCCCGCAAGCGAAAGCCACGT
TGGAGTTACTGTCAAGTCTGTGCGAGCAGAGCGATTGGAAGTGGACTGACGGCATGCTGCTTGGCGGTTGTTTGCACTAC
GGTCTAGATCATTTCGAGCAAGCTTTAGAATGGTTCAATCGGATTTTGTCTCTAAATCCTGGCCATGTCGAGGTCGTGTC
TAACATTGCCGCCACGCTCTACTGTCTCGACCGTCGCGACGAAGCGGAAAAGTTCTGGTATCAGGCCATTCATGCCCGTC
CCAGCTATCTCGAACCAGCAGAACACTTGGCCAGCCTTCTTGCTGCTGACCAGCGGAACCACGAGGCTGTGGATATGATT
GACTTTGTCCAGGACTCTTTACGCATACAAAGGCCCATCGGGTCCGTAAATAGTGGCAGCAGTGCCAACTGTGGAGGGGG
TCCAGAAGTTGCCGGTACAACTCCAATTTCGGGCTACAAAGTATCTGTCCATAACGATGACAGGGACTCATCATCGCAGG
GCTCGCCCGACAACACCAACACACAGCCCGGGTTTGGTTCGAGTGGCTATGCAGTGCCAGGACACGACAATGGACGGATG
CTCATTCTGATTCACACCAAGGCAAATATTCTATATGCGATGAAGGAAACTGCGTCAGCATCCAAGGCATACGAGGAGGC
TGTTCTTATCGGCACCGGCCGGGGGTTCCAGCGCATCCAGACTCTGATACAGCGTGTCCACGCCACCCTGTCTCCTGCCG
ACGTCTCCCAAGGCAGCCTTTCCTACTTTCCACGATCAACAGCAAGCCCCCCTCTCTTGTCACCAGACAGGGCGAAGCTA
ACGGCGCACCTTGTTTTCGCTTCTACTCATGGTCAGCTTCCTGGCCTTCGCTATATTCCAGAGAGCCAACATCGGAAGTC
GGCCATCGCGACAACTAGCAACGCCCTACTCTCCATGGCCAAGATCCTTCAGGACGGCATGGCAAGCACTGGTTATGCAC
CCGCCGGGCCAAATGGCCAGGGCTCTGCAGTTGCAGATATACTGGCGCTGTACTACCTGTCGTTGTCGCTTCAGGAAAGC
CCTTCAACTGCAAATAACGTGGGCATCCTGTTGGCAAGCGTGCAGCAAACTCCAATTCCGTCGGACTCGCAGTCGCAGAG
GCAGAAACCACAGCAGCAGCTGTCATCAGTCGTGGAGCCAGCCACAAAGCAGGCCATTCCTGCCGGCATCACTCCTGGCA
GCGGCTTGGCCCTGGCCTTTGCGTATTACAGCTATGGCCTCCGACTTGACCCAAAGCATGTCCATCTCCACACCAATCTC
GGCAGTTTGTTGAAAGACGTTGGACAAATAGATCTTGCAATCAAGATGTACGAGCAAGCTGTTGCGTGCGACGGCACATT
CGATATCGCCTTGACGAATCTGGCGAATGCTGTAAAAGACCGTGGACGCATTTTGGACGCGATTTCATACTACCGCCGCG
CCGTCATATCGAACCCAGACTTTTCCGAGGCTGTCTGTGGGTTGTCAACAGCTTTAAACTCAGTCTGCGACTGGAGAGGC
CGGGGCGGCGTTTTTCTTGAAAACGGTCGCTACGACCGCTGGCATGTCGATGACGACGGCATGCTGCGAGATGTCTGCCA
GACGTGGCATGGCTTGGGCCTCACCAAGCGTGTTGTGGATATCGTGAGCCGTCAGTTAGAGGAAGGATCTAGCTGGGGGA
AGGGTGTCTTGCACGAAAGTGCCATTGCAATGCTCGCGTGCCAGATGAAGGATGCGACTGGTGTCCTCGGCAGGGATAGC
GGCTTCGACATTGGAGAAGGTGGCGGCGACGGCGTCAACTCGGCAGAAGTTGCAACAGAGCTACAGAAATGGGCCAATCA
GACTGGAGAGGGCTCGCGAGTGCTCCGGCTAATCGAGCGCGCCACTCGTGTTGTTATGCGACGCTGGTACCACGACCGAT
ACGTTCGTGGTGTCGAGGTGCCCAACAACTATGCGAGGCCGAGATTGCCAGCCAGCCTGACGGTTCCTGCAGCACCAACT
GTGCTTCCTTTTCACACGTTCACCTGCCCCCTTCCGGCCAAGGACGTTCGTCTGATTTCTCAACGGAATGCACTCAGGAT
TTCCTGCTCAACGCTGCGCTCGCCTTGGCTATCGGGCTCAGTTTACCCTCCACCTTCCCCTCCACAGCCCCAGCTGAATA
TCGGCTACATCTCCTCTGACTTCAACAACCATCCTTTGGCGCACCTGTAAGTGGATCTGCTCTTGCCTCTGATTCTTGGT
TGCATATGTGAGGTACTGACAGAGTGCGACAACAAGTATGCAATCTGTGTTCGGATTTCACACCCCGTCAAGAGCAAAGG
CTTTTTGCTATGCAACTACTGCTAGTGACAGGTCGATACATCGCCAGCAAATCGAAAGGGAAGCACCAGTATTTCGCGAT
GTGACCAATTGGGCGCCCGAACGTCTGATCGAGCAGATCCTCCAGGACAACATACACATCCTTGTCAACTTGAACGGATA
CACACGCGGGGCAAGGAACGAGATCTTTGCTGCCCGGCCGGCGCCCATCCAGATGGCCTTTATGGGCTTTGCTGGTACTC
TCGGTGCTGAATGGTGCGACTACTTGCTTGCTGATACCACGGCTGTTCCGCCCTCTACACTGCGACCATGGCGAGGCAAT
GTCAGCATCGGTGACGTTTTCCGCGACGAGGCTGAGGCCGGCCAAGAGAACTGGGTGTACTCGGAAAACATTATCTACTG
TCGTGATACGTTCTTTTGCTGCGACCACAAGCAATCGGCCGAGGCGTCCGAACGAGCAATGACCTGGCAGGATGAGCAAC
GCCGACGTTGGAAGATGCGCAAAGAACTGTTTCCAAACATATCTGATGATACAGTCATTTTGGGAAACTTCAATCAGCTT
TACAAGGTACGGATTCTTGGCTGCACGACTGCCCGCGTGGCTGCTTTGGCATTGGCTGACTAACATGTACCTTAGATCGA
CCCTACGACGTTCCGAAGCTGGCTGCGGATACTAGCTGGTGTTCCAAACGCCATCTTGTGGCTACTTCGGTTTCCTGAAG
CAGGCGAAGCCAACCTGAGAAGAACTGCGCTCACTTGGGCTGGGGAAAGCGTGGCCTGCCGCATCATTTTCACAGACGTC
GCTCCCAAGCATCTGCACATTGCGCGTGCCAGTGTCTGCGATATTTTTCTTGACACGCCCGAGTGCAATGCGCACACGAC
TGCGGCTGACGTTCTGTGGTCCGGCACACCGCTTCTCACTCTTCCACGTTATAATTACAAGATGTGTTCTCGCATCGCCG
CATCAATCCTGAGAGGGGCGTTGCCCAAAGATGCCGAGGGCAAACAAGCAGCAGCTGAGCTGATCGCGGTTGACGAATCC
GATTATGAAAAGTCGGCGATCAGGCTCGCCAACAATAGTACTTACACTATGAAGCGGTATACTGGCAATGGAACTGACGA
GCTCTACGGCGAAGGGTCAGGGCGACTGACAGACCTCCGAAAGCTGCTCTGGCTTAATAGATGGACATGTGGACTATTTG
ATACCCGAAGATGGGTGTCCGACCTAGAAGATGCCTACGATCTGGCTTGGCGCAGATGGATAACAGGCGAACGGGGTGAC
ATATATCTCTAGAGATGGTGGTGGGTCTCTTGCTTAAAGCATGAGGAACAAACTCGGTCATTGGTTTGAGCGTTGATTTT
TTTGGGAGGAACGGATATTGTGGACAACGGAGTCCATTGGAGTCGTGGTAGAATACGGGATCCAGGAAAGCAGGATCATC
TCATTTGTTTTGGCATCGGACCCAAAAGGCTTCTTTAGCTTCTCGTCATGTTTTGAGAGAATCGGGCCATTGGTTGGGGT
TTTGGGGTTTCATTTTCAAGGGCAGCTGGACAGAGACAAGTTTCATGTCAATGTTCTTTCGTTGTCTTTTGTTTGGTACT
AGTGGTATACCCTTGATAGCAACGCAACGCTGTGGCCACTGCAGGTTTGCAAAAACGACAAAGCATGGGAGAAGCGTGAT
GAAACAGCTTCGCACCCAGTTTCAGACTAATAAAGACAGAAATCGTGAAGTCCGCTAGACATTGGCATCGCTCCTTCCCG
CTCGGGGTGCACTTGTTCTTATTTCAGGAAAGTCGGCAGCTGCGACCTCTTACGTTTTCCTTTTGGCATATTTCCTTTTG
CAGCCAGCTATACTGATTCTTTCTTCCCCTTCTCCCGTTTTCTTCCAGCTTCCATGCCATGCTTCGCACACCCTCTTACC
TTCGATAAGAGAAGCGATTGCTTTTGAGTCCATAACATCCACACAGACACGATGACTATTCTCTGGCAGCTACCCTGTCT
TGTCTCGAGATCGAATACTCGCCCGGCATCATCGTCGTCGTCCCACAAGCTATCGTTTCTGTACCACAGAAGCTCATTGG
TCGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62