GenePrediction:GLEAN_462 Details

Name: GLEAN_462
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1930472..1932918 (+ strand)
Length: 2447
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1930472..1930505 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_167:1930779..1931204 (+ strand)
Length: 426
Type: CDS
Source: GLEAN
Position: GCSC_167:1931267..1932918 (+ strand)
Length: 1652
>GLEAN_462 class=GenePrediction position=GCSC_167:1930472..1932918 (+ strand)
ATGGTCTACACGGAAAGCTGCAAACAAAAGGGATGTGCGGGAGTGCTTGTCTCGGTATAAAGTCCACCATAGACTTGAGA
TCCACGGTACGTCTATTGGCTGGTTTGATAGCCCAATCGGTGGCAGATAACCGTTTAGCTTATTTTCCCTGTACGAAGCC
GTCGTGTTTTCTGCTGGAAATTGCTGCTCAACATCTACCACTGGATGTAGAGCTTCACGATGCCACTTGGGCGACTCAAT
ATACCCCCGGATTTCCCGCCGGTGCATTCGTGTCGCCACTGTGACACTCTGATTCTCGATGCACTAGCGATACGGGAGAT
AGATGAGGGTGAGAGTGAGGATTCTATCCAGATCTTTGACGAAGATGGCGTCTCTATGCGTGGACCTGATATTCCATCGC
TTTCTTTCGCCGAGGCTATGGAAGCGGCACGAATACAAGAGGCGAAAGCCGACTCGGACTCGGTCAATATTATCGAGTCC
GACGAATGGACGCCATTCAGCCCGGATCTGACCACCGACGAAGTGCGGAGATGGGCAGAAGACGGCTGCCTATTCTGTGC
TGAGCTCATATCATCCGAAGGAGTGGAAGAAAGCAGTGGCAATTCTACGATGGTCTACTGGATGACAAACGAACCGTACG
AGAAGATGGGCATTATGGTCTTATTTGCGTCTCGGCAGGAAGACGGGTCCGTCAGCGATGCCTGGGGCTGTTTCAACCTG
CTCACATTTCCAGGTACGTGCTATATTAGCTGGACGACGAGCATGCTGCTGGCTGACGAGATGCGCGGACTGAAGGCGGC
GTTGCTTCACAGGTGATACCCCGGCATCCGATCAACACCGACCCGGCATCTGAGCAGTCATTTAAGCTCGTCAGAGGGTG
GCTGCAGACCTGTCAGAGTAGCCATGAGGGCTGTCCGAAGGTGACATCAAAGTTCATGCCGACTCGAGTGATTGAGATTG
TGGGCGATGGAGAGGACGGGATGCAGCTGCGGCTGCTAGAAACACGTGGGTTGATTGTCCAATATGTGGCCCTGAGCTAT
TGTTGGGGCGGGGAGCAGGAGCTGAAGACCACGGCTGCGGTACTGCCCCGGTTCAAGGAGAGTCTTCCGGCCTTTGCGAA
GCTGCCAGCGACGATCCAAGACGCAGTAAGGGTGACGCACGAGCTGGGCCTGCGCCACCTGTTTGTCGATGCCTTTTGCA
TCGTGCAGGACGACGGCGACGACATGCAGCAGCAGATTGCGCAGATGCCCGCGATCTACAGCGAGGCGGTCGTGACCGTT
ATCGCGTCGAGAGCGGCGAGCGTGGCTGATGGGTTCTTGCAGAAGAGGCCGTCGTCGCTGCCAGACACAGACGAAGAACG
CTACGAGGCTGCCTTCCAGCTGCCGATGCGATGCGCCGGAGGCGATCTGGACAGCGTCGTCCTGCTTCGGCTCGCCTACA
AGGGCCTGACTACAGATCCGATCTACACGCGCGCGTGGACGATGCAGGAACAGCTGCTGGCAACGCGCATAATTGCCTAT
AACCACAACCACACACGCTGGGGCTGCTGGTCTGCCCACACGCCCACCGACGGCTGGATCCAGGCCGGAGGAGGCGACGA
TTTTGTCCAGGCATGGGAGCCGGCCGTCTTTCGGGCCCCGTCGCTGTCGTCTGGGCCGCCTGTCCGTCCGGATGTAGAAA
CCGTGCGGTATGGATGGCGTCGGCTGGTGATGCAGTACACGTCCCGGTCGCTGAGCTTTCCGGGCGACAAGCTGCCAGCT
ATTGCCGCGGCGGCTGTTCGTGTTGGTGAGGCCTTGCGCCAGGACGACTACGTTGCCGGACTCTGGAAGTCCAGCCTGAT
CCATGACCTGTTCTGGAAGACGGTGCAGACAACGCGACAGGTCCGGCCGAGAGAATTTCGGGCGCCGTCATGGTCTTGGG
CCGCTGTGGACGGCGAGATTGACTATTTTGCACGCATCGTGGATCTGAAGTCAGCGACAGTCGAGGTCTTGGATTGCCGT
GTCGAGCCGGCACATCAGATGCTGCCGTATGGCGCGGTCAAGGGCGGCTGCTTGGTCGTCCGGGGGCGATTGCGGCGTGT
CGTCTTGCAGCTCGAAGCAACCGACAGAAATTTTTTTCATGCCACGGAGCCGGACCGAGAAGGATTGGAAGCTATGCTTC
CGGTGTCTTTTGACGCGATCGAGCCGGAATTCGCAAACACTGCCGGAGATTCCATAGATGTTGCCCTTTTGGAGCTGCAC
GACGAAAGTTCGGGAGAACCAGTGAGCCTTGTCCTGCGTGATCTTGGTAACGATACGTTCTGTAGACTGGGTGTATCGTT
TCGGTCTGCTATGGTGAGATTTCAGATCGGCGACAGTGTAGACGACGGTCGGGAACTGGCAAGATCGCATCTCGACTGGG
TGAAAGGGTTTGAGAAGTGTGTCCCAACGACGATTACTATTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62