GenePrediction:GLEAN_4633 Details

Name: GLEAN_4633
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1385197..1384546 (- strand)
Length: 652
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1385197..1385029 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_167:1384949..1384546 (- strand)
Length: 404
>GLEAN_4633 class=GenePrediction position=GCSC_167:1385197..1384546 (- strand)
ATGGCCAACTTTCGCCGCTTCACGCCTGGCGACCTCAACAAGCTTTCCAAGTGCAACCTCGATCCCCTAACCGAAACATA
CGAGCTGTCTTTCTACCTCCAATACTATGCCAAGTGGCCTGCGCTCTTCCAGGTCGCAGAAGACAGCGAGGGCAACATCA
TCGGATACAGTGCGCTCCACCCTTCTCATCTGCGCCGATCCTTTCTCGGCCAGCGGTCTCAATCATGTCCAGTGCTGACA
ACTCTTAGTTATGGGCAAGCTCGAGTCTTCGCCCGATGTCTACAAGTATTCGGAGCACTTCCTGCCCTGGCACGCCCACA
TCACGGCTATCACTATCGCGCCCGATGCGCGCCGGCTCGGTATCGGCAAGCTTCTGAGCGAACAACTGGAGGCAGCGGCC
GACGCCAACGATGCCTGGTTCGTCGACCTGTTTGTTCGCGTGACCAACTACCGCGCCATCACATTTTACGAGAGCATGGG
CTACAGCGTCTTCCGCGTCGTGAAGGAATACTACGGCGACCACTCGACAGATCCGAGCCAGAGCTCCGAGGACGCTTACG
ATATGCGCAAGCCAATGAAGCGGGACGTCAAGCGGGAACATGTACGCGACGATGGCAAGAACCACGAAGTTACGCCCTAC
GACGTGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62