GenePrediction:GLEAN_4635 Details

Name: GLEAN_4635
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1379692..1378082 (- strand)
Length: 1611
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1379692..1379598 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_167:1379459..1379364 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_167:1379282..1378082 (- strand)
Length: 1201
>GLEAN_4635 class=GenePrediction position=GCSC_167:1379692..1378082 (- strand)
ATGGATCTCGCAAAAACGCTCGTGCGGTCCGTGGCCCGGGCATTTTACGAGACGAAGCACATCTTGATCATTGATGCCCT
GGTCATCCACTCGGCGTATGTTTCTCGTCTGTGGGAGAGCAGGGAGAGACTGTCTTTGCGCTTGGAACTTCTGTGCCAGC
TGCGTTGACGCGGGGCTCTTCTATGTCCTTTTGCTACCGAAGCTGACCGTCTTCCCTCGACCGGGGTCCATAGTGTGCCA
GACGACGATCTGGCCTATCTGATCAGCATGAATATCAAGGACCTGCGCAAGATGTGCCAGAAGCTACGAGAGGATCGCCT
CTTGGTCTCGTATGACACGGCCCGCTTTCCTTTAGCGGTTTCTCTGTCTGGTTGGTGCTAACAAGCTGTGCCTGGCGAGA
CGGTATGTAGACATTCACGGTCCGAACTTCGAGAAGGCCAGCAGAGGCCCAACAACCGAACGTACTACTACATCGACTAC
CGTCAGACAATCGATGCCATTAAGTGGCGTGTCTACAAAATCGACAAAGACCTACAGGGGCCAGTTGTGCCGCCTAGCGA
GAAGAAGGAATACTTTTGTGACCGCTGCAAGGCGGAATGGACCCAGATGGAGGTGCTTGACAGCTCTAGTACTTCAGGGT
TTCTGTGCCACCGCTGCGGCTCTGTCCTTCGCCATGGCGATGGCGGCCGGGCGGGTGGCCATGAGCGCAGCACGCGCATG
AACAACCAGTTCAAGTTTATCACCGAGCTGCTGCCCAAGATCGACAGCGTCGTCATCCCCGATAACAACTTCGAGGTAGC
CTTCAACAATAAGCGGCCGGTCCTTCGTGACGCGACGCACCAGATAGCTGCCAGCATCGGCGTCGACGCTATGAACAGGC
CCACCGCAGTCAAGGGTCTTGCCAACACGGGTCCCAGCACCCTGTCTGTCTCTATACAGGCCGGCAGCGGCCCCACGGAG
GAGGAGAAGGCAGCCGAGCGCGAGCGCCGCGAGCGTGTCGCTGCGCAGAACGCGCTTCCTAGCTGGATGTCTAACAGCAC
GGTCACTGGTGAAGCTTTCAAGACGGACCTAGCACCTGGCAAGGGGCCAGGCAGCGGTGCCGATGCCGACACCAAAGACC
CGACCATCAAAGCCACAAACGACACCAACGCCGAGGCCGATATCGACGACTACTTCTCGCGCCTCAAGAGACAAGCGGCC
GAGGAAGCACGGAAGAAGATGGCGGGAGCTGGCCAGGACGACGAGGACGAGGATGAGGAAGACGAGGATGATGCCGAGTT
TGAGGACGTGGTACAGACCGCCGGCAGCACTCCTGTGGCAAGCGGCACTCCAGGCAGCTCGAATGCCATCGGACTGGCAC
CGCCAACCTCGGTACCACCCCCACGGTTAGGGTCTATACCCAAGGCGCCGTCTCCGTTGCGGCAGTCGTACTCGCAGTCC
AACCTGAAGCGCGAAGCGGTGTCAGAGCCGCCAAGCCCGTCTGAGGCCGGGCGGCTGGCAAAGAAGGTCAAGGTGGAGGA
CGAAATCGGAGAAGTACCTGTTTCGGCGGTAAAAGCCCAAGCAGAGGATAGCGACGAAGACGAGGACGACATCGAGTTTG
AGGACGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62