GenePrediction:GLEAN_4637 Details

Name: GLEAN_4637
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1367705..1364777 (- strand)
Length: 2929
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1367705..1366013 (- strand)
Length: 1693
Type: CDS
Source: GLEAN
Position: GCSC_167:1365948..1365468 (- strand)
Length: 481
Type: CDS
Source: GLEAN
Position: GCSC_167:1365410..1364777 (- strand)
Length: 634
>GLEAN_4637 class=GenePrediction position=GCSC_167:1367705..1364777 (- strand)
ATGCGCCACACGAAGCTGGTGGTCGGGGATGAGCTCTTTATCCCACCGCAGAAACGGTACGTCATCACGATGCCGTTTAC
TGCTGTTGAAGAGCAGCATTATCAAAGCCTTTTCAGGCAGCTTGCCGAGCTGTGTGGATTGGATACCCATGGGGCTCCCT
TGCGGCCTGACTGGGACCCTAACGACTCTGCTGTTTTGGAGGCCATGCGATCGGCCTTGAATCGTCTCCGAAAAACCGCG
CTTCACCCGGAAATCGGCGATCAGAACCGCCGTGCCCTCGGCCACCGAGCCGGACCCATCAGGACTCTGGCAGACGTTCT
GGACACAATGATTGAGCAGAGCGAAAGCTCGCTGCGTGTCGATAGGAGGGCCATACTAACACACAAGCTGAAGCGAGGTC
AGATGCTGGAAAACTCGCCTAGAGTACAGTTGGCCCTTAAACTCTGGCAGGATGTGCTGAAGGAGAGCAAGGCGCTGGTG
CAGGCAGCTCGGGAAAAGCTGATCTCGGAGTTAGAGAAGGCGAAGGAGGCCGGAGTGAATGAACCCGATGGGAAACCGCA
CAACGGAAGATATGACGACGATAGCGAGAGCGACGAAAACGACGCTGATGACCAAGATAAGGCGGCGGGTGGACGTGTAG
GCGACGCACAACGCGAGCTGCGATATGCACTCGAAATTCAGCATAGGGCGGAATTTTTCTGTGCCAATGCGTATTTCCAG
ATCAAGTCCAACGAGACGATGACGGCACTTGATTCGGACGAGTTCAGGAGGCTGGGGAGACTGGAGACGGAGGGGTACGA
ACGGGCCAAACGAGTTCGACAGGAGATCCTGCAGGAAAACCGCGGCAAGGCCAGACGGAAGATGGAGGAGCTTTCGGGGA
AGGCAGCCTCGCAAAGCTTCACTGTTATTCCAGAGTGCGTGTTTGCGAAGCCAGGTGGCATCGAGGGACGCCGAATTGCA
GAGGAGCTGGAAGAGTTTGGTGGCCTACTCAACGACCAGGCAAACCAGATCGACAGCTGGCGGGAGGCGGTGATACAGTT
GCTGCTAAAGGACCTAGTGGATGAAGACGACGAGATCGAGATCACGGGTGACGAATACGAGAACTCGACCAAGGTTCAGG
ACGAGATCCAGGCCTATCTAACCATTCTCAAAGCGGCTATCAGCGACCGGCACGTTGCACTGACAGGCATCGCACCAAGC
GAGCTAGCCAAGTACGAAGAGCAGGTCGCGTATCGGCTGGCCGAAAACAATGACGGGCCTGCACCGAAGCTGATGATGCG
CCTGTTTAAGGAGCGACAAGCCGTCGTTCCCGATCTGCAGGGCAAGCAGAGTCCGTGGTCCCTGAGGGCAGCTCTGGTGT
CTCTGCGGGAGAGGTTGGCCAAGTTGCGCATCCATGCGAACAGCGACAACCGTCGGGCGCAGGTAGAGCAGGCCAGTATC
ATGGAACAGTTGAAAAGCACACAGGAGCAGCAGACAGAGCAGACCAAGGCGGTCGCGATGCTCGAGAAGGAGGCAAAAAA
GGTGCGGAGCGCGCTCAACACGCGAATTGCGTTCTATCGACAGCTGCAGATCGTCTCCGACATGGTGGCCCTCTACGAAG
GCGCGCGAGATGACGAGGCCATCACGGCCGCTGTCCAAGAAGAGGAGAACCTAGGCAATGCGCTGGCGACGGCTGAAGCG
AAGCACCGGTACTGTAAGTGATGTCGGGGGTGTGGATGTGTTTGCGCCTTTGGCCGACTTCTAACAAATCATCGCAGTGG
TGCACCTTAAGGAAACAAACGCCAAGGATGAACACCGGCTTTGCGTGATCTGCCAATCGACGTTTGTAGTGGGCGTGCTG
ACGGTGTGTGGCCACCAATTCTGCAAGGAGTGTATGACAGCCTGGTTCCAGGCGCATCACAACTGTCCGATGTGCAAGCG
CAAGCTCAGCCTGGCGAACTTGCACAATATCGTTTTGAAACCACAAGCACTCAAGGTGGTCAGCGAGAGCGCAGCCGAGG
GAGACCATGGAGACCATGGGGACAACAGCAGTGGAAGCAGCCGAGGAGACGTTGGCGAGCAGTTTGGACGGCAGACAGGC
CGGTCGAAGAAGACGGGCATCTACTCGAATTTCAGTGCGGACCAGCTGGACATGGACTTGCCAGGCCCGTCATTTACAAC
AAAGGTAGACACGCTGATCCGTCACCTGTTATGGCTGCGGTCATCGGACCCTGGGACAAAGGCGATTGTGTTTTCGCAGT
ACGTCTGATTCGGATTTAGAATCTCTATGTTACTCTGTTTCTCACCCCGACTTAGGTTCCCCGAATTTCTCGTCATTCTG
GCCCAGGCTTTCACGCACTACCACATTGGCTTCTCCCGGTTCAGCGACTGCGACGGCATCGCCAAGTTCAAAGAGGACCC
GAGCATCGAGTGCTTTCTACTGCACGCGCGAGCGCACTCTAGCGGGCTCAACCTGGTGAATGCCAACCACGTGATTTTGT
GCGAGCCGTTGGTCAACACGGCGCTGGAGCTGCAGGCCATTGCACGGGTGCACCGGATCGGGCAGGAGAATGAGACGACA
GTGTGGCTCTACATTGTCGACGGCACGGTGGAGGAATCGATCTACAACCTGTCGGTGCAGCGACGGATGGAACACATGGG
ACGGAATCTACGCGGCAAGTCGGCCGAGTCGACGCCCGAGCTTCTGGACCGAAACCTGGAGCTGGCCAACTCTTTGGAGA
TGCAGCAGGCGCAGCTGTCGAAGCTGATGAGTAAGAACAAGATGGCTGGTGAGGAGGTGGCCAAGGCCGATCTGTGGAAC
TGTCTTTTTGGCAGCTCGGCGCGGCGGTCAGCTGCAGCGACGGAGGCGGCGGATGAAGAGCAGCTGCAGAACAATGCATT
AGTGCGGCGGCATCTCCTGGCCAGCGTTGCAGAGGAGAGGCAGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62