GenePrediction:GLEAN_4638 Details

Name: GLEAN_4638
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1364238..1360640 (- strand)
Length: 3599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1364238..1364115 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_167:1364046..1360640 (- strand)
Length: 3407
>GLEAN_4638 class=GenePrediction position=GCSC_167:1364238..1360640 (- strand)
ATGTCCTCATACAACTACAATGGTGGCGGCCGCCAGGTGGGCTCGGGTGGCGGATTCCGGAACAGCGGGATCCTGGGCGT
GCTCCAGGCGACGCAGATCGACAACAAGAGCGTCTTGCCAGCAGGTCAGTAGCTGGCAGGTAGAAGCTGTTTCGTTGTCT
CCAAGCTGATCCATATTCTTCTGTCGGTATAGAGATACTCTTCACCATCCTGGATCACCTTCCCGTGCCAGACCTGATGC
GCTTCGCCCGCGTCAGCCATCTGTTCCGCGAGATGGTCTACGACGACACCCGGTGGGTATCCCGGCTGCAGAGCATGGGA
TGCTGGAACGAAGTGGAGGCACGGCGGCGGTTTGAGGAGGCACTGGTCCGGCGGCGGCGCGATACGGCGACAGCAGCAGC
AGCAGCAGGCGGTCTTGCTATAGCAAGAGGAATGGTTGGCCGCGGAGGTGGAGTGTTGCCATCTGGGGCAGCCAGGGCTG
GAGGGAGAAGTGTCGGCGGCAGCACGATGCTGTTTGACGCTCCGCTCGAAGAGGAGCGGCGAAAACAGCTGCTCGTGCTG
CGACAGAAACAACAAGAGCAGCAGCAGCAGCAGCAGCAGAAACTGGGACAGGTTCGTGACGGGTTCGAGACACTGGCGAT
CGAGGGAGTTGGCAGCCAGACAGCCCATGCAACAGCAGCAGTAGCAACAACAGCAGACAAGCAGCAGCCGCAGCGGGCGG
TGACAGACCCGCTGCAGGACACGGAGGCACTGCTGGACGTGCTCAAAAATGTGCGCAGCATCCGCGGGCATGCGCGCGAG
GAGTATGGCCGGGTGTACGGGGCACTAGCGCCGTTCTTCTATGACCTGGTGCGGGCCAAGAGTCACGCAGACCCGGCGGT
GTTCAAGGTGTTCCGCGACCCGGAGCGACAGGCGAGGATGCTGGCGAATCTGCAGCGGTTCGCGCACAGCGACTGGGCCC
AGGGCTGGCGGCTGCGTGAGGAGCGGCTGGCGACGATGGTGGGCATCTTTGAGGCGGCGGTGCTGCGCGAGTTTGAGCAG
GGCTACGAGTTCTGGGACGTGGACGGTCGGATGAACAAATACGCCAGCGTGCTAGACGTGCTCAACGGCAGCAAGGCGGG
TGTGGACCTCTTCATCCACAAGCACCCGCTCTTCTCGGACCGCGAAGTGGCGGCTAGCAACGACATGGAGTGCCTTCGAC
TGGCGCCGGCGGCGGCAGCAGCGACAGCAGCGGTGGCATCGTCGGCAGTCTGGGGGGATGCAGCGAGCGCTTCGGGTCAG
TCGGGTGTGGAGGACATCATCACGCTGGAGCCATCGCGGCAGTTCTTTGGACGACTGGCGGAAAAGGTCAACGAGCAAGG
CGTGATGATCGGACGGATCTTCCCGCGGCCAGCAACGGTGTTCTGGGCCTTTGTCGACAAGGTGCGCGAGGACATTGTGA
TGGAGTACATCACGCCGCTGCTGGACGAGACGCACGAGCGCAGCATGGCGGCCTACCTAACAGCGGTGTCGGGCCTGTTT
GAGCAGTGCCTGCAGTTCTTCCAGGCGCTTGAGCCGCCCAAGGGCGCCGAGGCCGAGAAGAAGGAGGCGGAAGCGGCAGC
AGCAGCAGCAGCAGCAGCAGCAGCGACGACGGCAGCGAAGGCAGCAACAGCAACAGCAGGCAGTGCCCAAGCGGCGGCCA
TGAATGGCAGATCAAAGAGAGCAGACCAGACGCGGAGTCTGTATGGTCGTATCGGTGGCGGCAGTCTCGGCGGACTCGGC
GAGGTGATCAAGGTCGAAGCCGAGGACGATACCGACGGCTGGACGGTGCGCGGACGTGTGCGGAAGGCCAAGGAGATGGC
ATACAAGACGTTTGAGCCGCATCTCGACCTCTACCTGCAGGAGGAGCTGGACTTTTTCCGGGAAAACGCGGAGAAGGAGG
TGGGTGACTGGGACAAGAAGCTGTCGGAGCAGGACGCCAGCGTCGAGTCGTTCTTTATGGCCAATTTCAACCGGCAGGAG
GTGAAGAAGGACTTTTTGAGCTCGTTCAAGAAGGTGGTGATGATGCCGGTGACGGTGTTGCCCGGCCAGCTGCTGGGAGG
CAGCAGCAACAGCAGCTCTGCACACACAAGCAGCACGGCAGCAGCAGCGACAGCAGCATCAACACCAGGGTCATCGGGAA
CGGCGACACCGGTTCCGGCAGTGAACATGAAGTCTCTGCCGGACAAGGCGCCCGACGACGAGCTGGCGGCCAAAGCAGCG
CTGATGGCGACGCGGCTGGAGGGCATCCGGTCGCTCTTCAGCATTGAGATGGCGCTCAACCTGGTGCACACGGCCAAGAT
GGGCCTGGGACGGGCAGCGGTGTTTGTGCAGCTGGACGGACGGGCAGGCGGCGAAGCGCGCGAGCAGTGTTCAGCCATCT
TTGTGGAGCTGCTGCGGGTTTTAGGCAACGGTCACGTGAAGCAAGGATTTGACCGGGCGGTGGAGCATCTGTCGCAGTAC
AATCCACGGGCAGGCGGTTCTGGCGGAAGCAAGAGCGGGAGTGGAACCGGGGCCGTGACGGGGACAGGTTCAGGCGAAGT
CAGCGAAGCCAAGGACACGGGAGGTGTGGCTCCGCTGATGACGTTTATCGAGCTGGTCAACGTGGGCGACCTGATCTCAC
AGATGATCGACGTGTTTTACGAGCAGCAGCTGGCAGGGCCGAAGATTGCGGACCGCAACGACTTTCTGGACGCGGCCGGG
CTGGCCAAGAAGCGGTTTGAGCAGATGATCGACGAGAGCGTGGCAGCCGGTCTGAACAAGGGCATCGACGTGTTGATGGA
CGAGGTGGAGTACATCTGCGCGACGACGCAGAAGCCGACGGACTACTACCCAGAGGCGGCTGATGCGGTGGCCGAGGGCT
TTCTGTTCTCGCTCAACGGGGCGCGGGCCAGCGTGATCGGCGGTGTGGGTGGCGGGACGTCAGCGGGCGCGTCGACGCCC
AAGTCGAAGCGGGCATCATCGCCGGCAGGAAGCGAATTCTCTGCATTTGCGGCGGCAGCAAGCTCTGGCTCCGGGGCAGG
ATCGGGATCTGGGAATTCGGCGTTTGCGTCGGCTTCGGCTTCGGCTTCGGCATCGACTGGTGGCTCGGGTGGCAGCACGT
CGGCGGTGTTGGACATTGGGCCAACGCGGACGGCTCTGCGGGTGGTCGAGCTCGTGCGTGGACACACCAACATGCTCAAA
GGCAGCACAGAGAAGACGATGCTGGAGGTGTTCAACGGCGAGGTTGGGCTGCGGCTCTTCACGGCTGTATGCAAGCATCT
TAAGCGGCAGCGGATTAGCATGGCGGGTGCTGTGCACGTGATCGCGGATATGACGCTGTATTTCGACTATGTGCGCACGC
TGCGCAACACGGACCTGCTGGCATACTTCCGGGCACTGCGCGAGCTCAGTCAGCTGTACCTGATCGACGCCAAGCACCAC
GCCAAGGAGATGGCGGTGATCATTGCGGACAACGACCGGTTTGGCGGTGTGTTCCGGGCAGAGGAGGTGTACGAGTTTGC
CGAACGGCGAGCTGACTGGTACCAGGTGAAGCGGGATGTGGAACGGGCAATGTACGGGCTGGAGTGTGCAGTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62