GenePrediction:GLEAN_4639 Details

Name: GLEAN_4639
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1358837..1357768 (- strand)
Length: 1070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1358837..1358817 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_167:1358736..1357768 (- strand)
Length: 969
>GLEAN_4639 class=GenePrediction position=GCSC_167:1358837..1357768 (- strand)
ATGTATGGGTTTTCGTATTGGGTACGTGTGTTCTGTTCGGCTCGGCTGCCCGTCTCGCTCTCGCTCTCCTCCCATCCTCG
GGCGGTGCTAACCCCTGACAGATGCTCCCGGTCGTCTCGGGGCTGTCGTGGCTCGGCATGCTCCTCGGCATGCTCATCGG
CTGGACCGTCGGGACACACCGCGAGCACTATGCCAACATGAAGGCGAGCCAGTCGGTGGCCTACATCAGCGACGTGGGCG
CATCGCCGCGCTTCAAGCCCGTCTTCATCGCGCTCTGCTGCGTCACGACCGCCTTTCTGGACCTCTCCTTTGTGGCCGAC
CGCTGGCTGCGTCATCGCGGCCGCCTGACTCCGAACGGCAGCACCGGCCAGAAGCTGCTGGCCGTGCTGGCCATCGGCTT
TGCCCTCGCCGGCACCGCCGGCCTCATCCTGCTGTCCGTCTTTGACGTCGCCCATCACAAGCGCCTGCACGACGGCTTCT
TGCTGCTCTTCCTCGCCGGCTACGTGCTCGCCGCCATCTGCGCCTGCTGCGAGTTTCACCGCCTCGGCCGCCACAACCGC
GCCGTCCCTATCCTGCGTGCTTCCTTTCGCGTCAAGCTCGCCTTCATCCTCGTCGAGCTCGTCCTCGCCATCGTCTACGT
CTGCCTCACCTTTACCCACTCGCCCAATGGCGGCGCTGTCATCGAGTGGGTCATCGCCTACGTCTTCACCCTCTACGTCC
TCTCCTTCGCTGTCGACCTCTATCCGGCTGTCCACACCCGTCACGGCCTGCCGCCCAAGAGCGCTGCCGAGACCGTCGGC
GACTCTGAATTCGCTGGTCCCGAATCCAATCCCGTCCGCCTCGCTAGCCTCAATACCAACACTGCTGCTGCTTCTGCCCC
CGTCGACTCGGAAGCGCCTGCCGAGATGCACGACGCCTATGGCCAGAGTGCGGCTCGTGCTACTCGAGCCTCTCGCTCGT
CACGTGTTCAGCAGGACTCTTACGCTGCTGACTACGCCGCCGGCAACGGCAACACCTTTGAGCCTGGTCGGGCTTACAGA
CACCGACATGAGCTTTCGGGGACCATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62