GenePrediction:GLEAN_463 Details

Name: GLEAN_463
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1955118..1956949 (+ strand)
Length: 1832
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1955118..1955145 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_167:1955201..1956680 (+ strand)
Length: 1480
Type: CDS
Source: GLEAN
Position: GCSC_167:1956742..1956949 (+ strand)
Length: 208
>GLEAN_463 class=GenePrediction position=GCSC_167:1955118..1956949 (+ strand)
ATGGCCATCCAAACGGTCGCTTATGCAGGTATGAGTCCCAACTAAACCAACTTACAGAGCCGCCTGCAGTCTGACAAGCG
CAGGAGTCCTGGCGGCTGCAGACCACGCGGCGGCCGTGCTGAGCCTGGCAGGCCTGTCTGTGGTGCTGCTGGCCATTCTG
GTGTACGGGCCGCTGTGGGTGTCGCCTCTGGCGTGCGTTCCGGGCCCGAAGCTGTTTGCGCTCTCGCGCTGGCGCCTGGC
TCTGGAGGACTACCGTGGCTCGCGTACGCGATGCATCCGGGCGCTGCACCTGTCTTACGGCTCTGCTGTGCGGATAGGAC
CAGCCGAGGTCTCGTTTGCGTCGCTGGCGGCGCTGCGTGCCATCTACGGCGCTGGCTCTGGCTTTGAGCGCACCACCTTC
TACCGCATGTTTGACGTCTACGGCCGCCAGAACCTGTTCACGTTTGCGCCCGTGCGCCAGCACGCCGCCCGCAAGAAGCT
CGTCGCCCATGCCTACTCCAAGACGGCCGTGCTGCGGCAGGACGGCGCTGCCGTTCCGCTGATCGCCCGCAACGTGCGCT
CCTTCTTGGCCCTGCTCGAGCAGCGTGTCCTCGCCGGCGAGCCCGACGAGATCTTCCGCAGCCTGCACTGGTTCAGCCTC
GACAGCATCACCGGCTTTCTCTACGGCACCGATCGCCACGGCAGCACCGACGCCCTGCGCGGCAACGAGGCCCACCGACG
CCTCCTCGACGATATCCTCAACCCGGAGCGCCGTCGCCTCAGCTGGTTCGCCGTCCACCTGCGCGCCTACACCGCCTGGC
TGTACTCCCGCACCGGCCTGCTCGATCGCCTCATCGTCGCCCTCGGCCTGCTGCCCATGTCCCGGCCTGCCACCTACACC
GCCATCCGTGCCCACGCCCTCGCCTCCTGGCTCGGCTACGAGGCCGACGTGGGTGCCGGCAGGACCGTCTTGCCCGATGG
TGCCACGGATGCCTCCATCATGCAGCGGCTGCACCACCACAGCCAGGCCGGCGCCAAAGCCGGTGCTCGCAGCTCGCTGG
ATGGTCTCGACATCGCCTCCGAGCTGGCCGATCACTTCCTGGCCGGTATCGACACCACTAGCGACGCCAGCATGTTTGCC
ATCTGGGCTCTGTCACGGCCAGAACACGCTCACTACCAGGCCCGCCTCCAGGCCGAGCTGGCTGCCCTCGACTACGGATG
TGGTGTCAGTGAAGACGGCCAGATTGCCGCTCTGGACGAGCACGGAAACCCGACAGCAGATGCGGCTGACCGGTTGCCCT
TCCTCGACGCCGTGTTGCGAGAGACGCTGCGCCTCTATGCACCGCTTCCGGCGTCTGAACCTCGCGTCATGCCGACTACC
GACGTCGTCATCGACGGTGTTCACATTCCCGCCGGCACTGTCGTCAGTATGGATCCCTACACGCTTCACCGCAATCCGGC
CGTCTTCCAGGACCCGCTGGCCTTCCGTCCCGAACGCTGGCTCGGTGAGTTTGGTGACGTCTCCGAGATGCGCCGCTGGT
TCTGGGCCTTCTCCAGCGGTGGCCGCATGTGCATAGGCATGCAGTAAGTAGCCACAGGCCGAAGAGGGGAGAGAGAGACG
TGTGATAATGCTGACTAATCACAGTCTCGCCATAGCTGAGATGACCATGTTGTTGTCTGCAATCTACCGGAAATACTCGA
CAAAGCTGCACGCACGCCAGGAGGGCGTCAGCCCTGGAATCACCAGCCGCTTCGAGGTGTTCAGTGACAGTACGCTGTCC
AAGGTCTCGGTGAGTGGAACCTCTGCCTCTTTTGTCTTTAGCTCTCTTTCCCTGATCGTGACAGGAACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62