GenePrediction:GLEAN_4642 Details

Name: GLEAN_4642
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1342525..1338912 (- strand)
Length: 3614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1342525..1342353 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_167:1342207..1341508 (- strand)
Length: 700
Type: CDS
Source: GLEAN
Position: GCSC_167:1341454..1341226 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_167:1341168..1340312 (- strand)
Length: 857
Type: CDS
Source: GLEAN
Position: GCSC_167:1340222..1338912 (- strand)
Length: 1311
>GLEAN_4642 class=GenePrediction position=GCSC_167:1342525..1338912 (- strand)
ATGTCGATCCACGGCTATCGCCTCGTTTACCGTCTTCACTTTTACCTATTCGCGTCTGAGCTTCCTTTCGAGACGAAGGG
AGCTTCTGTCTCCGCCTTCCGGACGGCACCGGGCGGCCACAACACAAACACATACCGACATTGGGTGGCGGAAGAGGCTG
ACGGCCCTCGGACGTCCCAGTCACGATGTATGGCCATTTTCTGGGTTCTGTTTAGCTGTTCCGCTGTTCCGCTGTTCTGC
TTGATCTTCTCTTTTGTTCTTCTGCTCTTAGGACCAGAATGTCGGTGGACTAACCGTGACGGCTCTTCTGCCATGCAGGT
TCGAAAAATCGCTGCTAGATCTCATCCGGGGTCTCCGCTACCACAAGGGAAACGAGAAGGAGTACATCCAGAAGAGCCTA
AAAGAATGTCGGGCCGAGGTGCGCAGCCAGGACATGGACGTCAAAGCGACAGCGCTGCTGAAGCTAGTCTACCTCGAGAT
GGTCGGACACGACATGTCGTGGGCGTCGTTCCACGTGCTCGAGGTGATGTCGTCGCAGAAGTTGCACCAGAAGCGCATTG
GATACCTGGCGGCAGTGCAGAGCTTCCGCACGGACACGGAGGTGCTGATGCTGGCGACCAACCTGCTCAAAAAGGACCTG
TGCTCATCGTCGCCTGTGACTATCCAGCTGCCGATTGCGGCCCTGCCACACCTAATCACGCCGTCGCTGGCTATGTCGGT
GTTGCCAGACCTGCTTCCGCGGCTCAATCACTCGCACCGTGTGATCCGCAAGAAGACCATTGTGACGCTTTACCGTATGG
CGCTCGTCTTCCCTGAGACGTTGCGGGCAGCGTGGCCCAAGATCAAGGACCGGCTGATGGACCCGACCGAGGATCCCAGC
GTGACGGCGGCCATTGTCAACGTGATTTGCGAGCTCGGATGGCGCCGGCCACAAGACTTTCTGCCGCTGGCACCGCGGCT
CTTTGAGCTCTTGGTTGATGGCGGTAATAACTGGATGGCCATCAAACTGATCAAGCTTGTAGGTTCTTGGAATCTCTTTC
TTCTTACTCGTCTTTGAAGTTAACATGATAGTTTGCGACTTTGACGCCACTCGAGCCTCGTCTAGTTCGCAAGCTGCTTC
CGCCCTTGACCGACATCATCCGCACGACACCGGCTATGTCGCTTCTCTACGAGTGTATCAACGGAATCATCCAAGGCGGC
ATACTGGGCAGCGACGACGACATATCCGGGCGGGAGGAGATCGCGTCGCTCTGCGTGACCAAACTGCGAGGGATGATCAT
GGTCCATGACGACCCCAACTGTGAGTGCTGGCAAGACATGGCGGCCTGCTGCAGACAGACTCTGACATGGTGGACAGTGA
AATACGTTGCGCTGATCGCGTTCAACAAGATCGTGTCGACACACTCCTTCCTCGTATCGGAGCAGGAAGACGTGATCATG
GAGTGCATCGACAGCCAAGACATCAGCATCCGGATCAAGGCGCTCGACCTGGTGCAGGGCATGGTCAGCAGCGACAACCT
GATGTCGATTGTGGGCCGGCTGATGCGACAGTTGAAGCAGTCGACGTCGGCAGCACCGAAAAAGACGACCGAAGTGCGAC
AGCTGGAGTTCCGGGCAGACTCTGACGACGAGGCAGAAGCGGCAGCCCAGCCGAAGAGCCAGGAGGCGCTCCTGCCGGAG
GACTACAAGATCGACGTGATGCACCGGATCCTGTCCATGTGTGCGCAGAACAACTACAGCAACATTGCGGACTTTGACTG
GTACATCGACATCCTGACACAGCTGTTGCGGACAGCGCCGCCGTCACGGGGGGGTGACAGCGACGGTGGCGGCGACAGCG
ACAGCACGGACGCGAACAACGGGCCGTGGTATGTGCGGACAGGCAGCACAGACATCTCGGAGCGGGTCGGCAACGAGCTG
CGGAACGTGGCGGTCAAGGTGCGGGCGATGCGGGCAGCGGCCGTGGGGGCAGCCAACTCGGTGATTGGGCAGCTCAGCAC
AGAAGCGGCATCGGCGACGACGGTACAGGTAACGACGCGGTCGCTGCGGCCGATGGTGTGGATGGTGGGTGAGTATGCCG
AGCTGCTGGAGTCGGCCGAGGACACGCTATCGCTGCTGCTGCAGCTGGTACCACGGATCCGAGCGGCGGAGGTGTTGGCG
ACGTGCGTGCAGGCGCTGGCGAAGCTGTTTGCGTTTGTGGCGGGCAATGATGCGGTACTGTGGACGGCCGAGCGGCGGTC
TTTAGTGTCGCTGCTGATCGCGCGGATGTTGCACGCGCTGGAGCCGTTATCACAGCATCCGAGCCTGGAGGGTGGCAGGA
GCGAGCGGTTGAGCTGTCGGAGCTGCTGCGGCTGGCAGACGAGGCAGCGTCGGCGCAGTCGCCGTCGATCGAGGGCGTGC
AGCAGGACGCGCCGCTGCTGCTGACGGAGGCGATCCCATCGTTGTTCCGCGGCTGGGAGCTGAACTCTGTGGCGGCGGGA
GCGCAGCTGAACATACCGCTGCCACAGGGCTTAGACCTGGACGAGCCGATCCACGCAAATCTGGGCGCGCTGTTGGCGGC
AGCGGCAGCAGCAGATCAGGATGGCGGGCAGATCACGACGGGTGGCGTCAACGACGACGACGACTTTGACGCATACTACT
ACCAGACAGCAGCACCGGCCAGCATCTCGTCGGCAGAGATGCCGGCCATTAGCAGGCTGCCAGAGGGACCGGAAGCGGGG
TCCTCTTACCAACAACAGCAGCAACAGGCTCCAGACGAGGAGGCATACCTTGATGCCGACATCCTAGCGAGACGCAAGGC
CGAGCGAGAAGAGCGGTACCGCGATGATCCGTTCTACATCCAAGGGAGTGGTGGCAAGGGGCTGCGAACATCGACGCCGA
TCCACGACATTCTGACCAAGGAAAACGGCCAGGACCTGGATATTGACTCGATCCCGGTGATGCAGCTGGACCTCCAGGCT
CTGGGAGCGGCCAAGGCGCGGCCGAGCGGCGCGACAGGGCAGCCGCATCAGGCACGGGCGCGGCCCAAGAGGATTGTGGT
GGCGGCAGATGAGATGCTGGCCGGCAGCGGACGATCGACGCCGCGTAGCCTAGAGTCGGACGTGTCGAGCGACGGACGGC
AGCAGCCGCGCCGCAAGACGACGAAGCACCAGCAGTCGCTACTACAGGTGGACTCGAGCTACATTGGGACACTGAGCCTG
GAGGAAGTGGCGGGAGATGGGGAAGGGGGTGGAAGTGGAAGCAGTAGGGCGATAGCCAGCAGTTACGACTACGAGCGGCA
ACGACGAGCCGATGCGGAAATGGCACAGGCGCTCAAGGAAGTGGAAAAGCGACGGCTGGAGATGCAGCGGGCCAACGAAC
GGGTGCAGATGGCGCAAGGGATCCCGATCGAGGGTGTGGTGGTGGTGAGGAAGAAGAAGAAGACGGCGACGAAGAAGGCT
GTCGGAACGGCTGACGGAGAAGTCGTGGCAACCAAACCGAAGAAGAAGGCAGCTGCAGCAGCAGCGGAAGCTACAACGGA
AGCCTCAGCGGCAGAGACGACAGTCATTGCCAAGCCGAAGAAGAAAAAAGGCAGGAGGATAGTAGACCTGGGGGGAGAGG
AGCCGGGATTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62