GenePrediction:GLEAN_4644 Details

Name: GLEAN_4644
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1334251..1332240 (- strand)
Length: 2012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1334251..1333512 (- strand)
Length: 740
Type: CDS
Source: GLEAN
Position: GCSC_167:1333283..1332761 (- strand)
Length: 523
Type: CDS
Source: GLEAN
Position: GCSC_167:1332704..1332240 (- strand)
Length: 465
>GLEAN_4644 class=GenePrediction position=GCSC_167:1334251..1332240 (- strand)
ATGACTCGTGTTCCCACCGAAGAGGATTTTGCCTCGCTGGCCCCCGACCTGACCGTCGCCCTGCATTTTCCCGACCCGCC
AGCCTCCACCACGGCCATTTTGCTGCTCTTCCACGGCCTCGGCGACAGCGAGGCCCCCTTTGCGTCCTTTGCCCGCGCCT
TGAACCTGCCGGGCGTGCTGGCCGTGGCCGTACGCGGGCCCAACGCGGTGCCGTTTGGGGACGATGTCGACGACGACTTT
GGCACTGGCCCGCGCCATTTCCACTGGGGCGACGATCTGCAGCTGCGCGGCGCCGACATCGACCCCGATCCCGGCTTCGA
CCGCGCTCTGCGTCTCGTCGGCGGCCGCCTGGTGCGTGACGTCCTGGGTGCCCGCTGCGGCTGGCGTCCCGACGACCTGC
TGCTCTTCGGCTTCGGCCAGGGCGGCACGTTTGCGCTGGCCCTGGCAGCTGCTGTACCGACAGAAACCCCCTGCAAGGGA
GTGATTACTGTCGGCGCCGACGTGCCATCCGCCATCGCCGTGGCCGCTTCCGAGGCTCCCAAGACCAACACGCCCCTCCT
CGTCTGCGGCGCCGTCGACGGCGAGGCCGTGTCCGACGAGACCGTGTTGCTGCTGCGCAACCGATTCGCTGTCGTCCAGA
CTGCCCGCTGGGTCCGGCCGTCCGGCGACGACGCCATGCCGCGCAGCCGAGCCGAGATGCTACCCATCATGCAGTTCCTG
CTGCCGAAGCTGCGGGCCTGGTAACCGGGGAGGAACGGGTGGCCTGAGCTGGGCCGCGTTTCAGATGGGGTGAGGGATTA
TTGATTTGGAAAACTCATGACAGCGGCTACTTGCAACTGCCATTTGTCCTTGTGTCTTTGCACCGCTTCCACCACACAAC
GACGCGATGCTCTTCAATCTGTAAGTCAACACACCACACGCCGCTCTTCTCTCCTTACGCCTTGATGGCTGACAGACAGT
CGTCCCAGCTACCCCTTTCACTTTCTGTGGGGACAGTGGCACACGATCCCGCTGCCCCCCTCCGGCTTCTTCGCCGGCCA
GACCGTGCTGGTCACCGGTGCCAATGGTGGTCTCGGCCTCGAGGCTGCCCGTCATATGGCCCTTCTCGGTGCCGCCCGTG
TCGTCTTGGCCTGCCGCTCCGTCGAAAAGGCCGAGGCTGCTGCGGCCGACATTCGCGCGTCGCTGCCACTCGATCGCCAG
CAAGACTGCGTCATCGACGTCTGGGATGTCGACCTCGCCTCCTTTGCCAGCGTCGCCGCTCTGGCACGCCGCGCTGCCGT
CGAGCTGGGCCGCCTTGATGTCGTCGTCGAGAATGCCGGCGTCGCCCGCCCGACCTTTTCGCTGGCCGACGGCCACGAGA
CCACCATCACCGTCAACGTCTTGTCCACCGGCCTGCTCGGCCTGCTGCTGCTGCCGCTGCTGCGCCGCACCGCCATCCAG
TACAACGTGCGGCCACGCCTGGTCGTCGTCTCGTCTGATGCCCACCTCTTTGTGAGCCTGGCCTCCTCCCTTTTCGTCCT
CTCGCTCCCCTATGCTCATACTTGCAGGCTCGCTTCAACGAGACCAAGGCGCCGTCCATCTTCGAGGCTCTCCGCGATCC
CGCCCACATGTCGCACGACCGCTACAACGCCTCCAAGCTGATGGAGGTCTACTTTGTCCGCCAGCTGGCCCGCGTCCTCG
ATGCCCATCACATTCCCGTCACCGCCAACTGCCTCAACCCGGGCTTCTGCCGCACCGAGCTCTTCCGCAGCGTGCCCGTC
CCCTTCCGCTACGTCGTCCAGGCCGGCCTCCATCTCCTCGGCCGCACCGCCGAGATGGGCGCCCGCACCCTCGTCGCCGC
CGCTGCTGCCGGGAACGAGTCCCACGGCCAGTACATGGACTCGGGCATTGTCTGGCCGCCCAGTCCAGCCGTCACGTCTG
CCGCCGGCGTTGCTATCCAGGAACGCCTCTTCGGCGAGCTGCTGGACGTGCTCGAGAGCGTGCATCCGGGCGTCAAGGCG
AACCTCGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62