GenePrediction:GLEAN_4645 Details

Name: GLEAN_4645
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1323404..1321379 (- strand)
Length: 2026
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1323404..1322015 (- strand)
Length: 1390
Type: CDS
Source: GLEAN
Position: GCSC_167:1321768..1321625 (- strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_167:1321485..1321379 (- strand)
Length: 107
>GLEAN_4645 class=GenePrediction position=GCSC_167:1323404..1321379 (- strand)
ATGGAACCGCCAGACAGTTCGGGACAACCAAATCGATCGGCCGTCGTCCTTGTGCAAGACCTGCAGTCGTGCGTTCCGCT
GGGGAAAGTCCTAGCTGAAGGGGACCTTCTCTACGTTCTTACGCCGGCTGCCGTGCCAATCGAGTCAGCAAAGCCGGGAC
AAGCGCAACAGGACCCGTTCGAGCCCTTTGGTCGGGCATTGGCCACGTACCACCCTTGGGTTCGGCACATCCCTTATATG
GTCCGAGACGGCATTACTGGGTACCACGCCAGTCATCTCCGTCTCGCTACTGCTGTTATCTTTGTCATCACCGGACCACC
TTGCGCTGGCCAACCATCTCAGATCGCGCTCTCCCAGACCGCGCGACAATTCGTGCCGGACCGACCACAAATTGTGCTGA
CCTGCTGCAGCCTGCACGACCTGGGCTTAAGCGTGACGGACAGCCCATTTCCTACGCTGGTTGAAATACCAGACTACGCG
CGCCCGCACCTCGAGGCGGCTGCCGACTTTCTCTTCCGATCGCCAGCGTCGCCACGGGGCTCTCGATCCTCGCAGGATCC
GCCGTCTATGGCGCTATCGTCGAGGACGCGCTGGCTGGTGCAGGAGTGGGACGTGCGAGAGGCTCCCCTCGTCCATGAGC
TGTGGTGCCGCAGCCTGCCGTCCTGCTTCAGCCTCGACTTTGCGACCTTCCAGCGGTTGCTCCACCGGCCGGGCTACTCA
AAGCACTTTGTTGTCCGCAGCCCGTCTACGCATGAGCTGCTGGGCTTCTGTGCCACCTTTACCACCTTCATCGACAATAG
CGACTCGTCCTGGATCGGCTGTCTGGCCGCCATCCTCGTCCACCCAGCCCACCAACAGCGCGGAATCGGCACGAGCCTGC
ACAGCCATGCCATGCGCCAGCTGGCCGAGCACCGTGTGTCGCGGCTGCAGCTGGGCAGCACGTTCCCCCGCCTCTTGTAC
GGCATTCCGTACGGCATGCCGTCCGAAGACTGGTTCCGGCGACGGGGATGGCGCATCGACACGCCTGGGCTCGCCGGCTG
CGGCCAGGAGGCCTGCGACTGGGTCCTGGACTTTGGTGACTGGAGGGCAGATGGGCTGTCAAGTGGGGGGTTGACGTTTC
GGAAGTGTGAACTCAGCGAATTCGACCAGGTGCTGGAATTCGTGGCACGCGAGTCTGTCCGCAAGGACAGCGTAGGCTGG
TATGACCAATACTATCAGCTCGCTGGCACCATGGGCATCCATGACATCCTGCTAGGACTGGAGAGGGGCGTGATCGTCGC
CACTGCTCTCACCTACATTCCGCAAAACCACAGTCGGGCCGCTGACGACCTACCCTGGGCGGGCACCATCGCCGCTGATG
TTGGCGGTGTAGCGTGCATCTGCATCACAGGTACGTGCCTATTAGCCCCCCTACTCAATGAGGAAGGACGAGAAGCGAGA
AGGCCGGTGGGCGATGGGAACGAAGAAGAGGGGGGGCCGCGGCCTGAGACGCGGGAAAAGGAGGGAAAGAGGGAAAGAGA
AAAATTAGAAGAAAAGCGAGCAAGCCACGGGGAAGAGTGAGAGGGCCAGGCTGCGGGAGGGACCACTGACTGGCCGAGAC
AGTTTCTCACACACGTCGGCTAACTGAACCACGCAGACGACCACCTGTCGGCGGCCCACACTCGAGACTCGGTGATGATC
CGTCTGCTGGACTACTGCGTTCGCAGCCTCCAGGAGCAGGGCATGCGGAAAATGTTTCTCGACGCCATCCGAGGCGGCTA
CGAGGGATACCAGTCCATAGGTAAGAAAGAGTCCGGTACAGCGGCTGTATAGGGTGGTACGCTAAACAAAGGCCTGTGGG
GGCGGTCTAGGGTTTCAAAAATGGGCAAGATACAGGGACGTCTGGTGCGAAACCTGACAGACCCAACACGAAAACGCAGC
TATCTCAGCAAGCTGGGCGGACCGATTCCGCCGCTGTCCAGAATGCCTAGACAGAGCCACGAGGGCCAACGAGGTACAGA
TTCTAGAGCCAGGCCCAAGCAGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62