GenePrediction:GLEAN_4646 Details

Name: GLEAN_4646
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1312067..1308964 (- strand)
Length: 3104
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1312067..1311998 (- strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_167:1311910..1310033 (- strand)
Length: 1878
Type: CDS
Source: GLEAN
Position: GCSC_167:1309965..1309662 (- strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_167:1309594..1308964 (- strand)
Length: 631
>GLEAN_4646 class=GenePrediction position=GCSC_167:1312067..1308964 (- strand)
ATGAGTCTTCAGATCGGAAATATCGTGCAGCTTCTCGACTCCACGATCGACCCACAGCAACACAGAAAAGGTATGTCCTT
TGCGTTAACGTTTTCAGTTCGGTCTCAAGTGGGCTGTATTGTGGTTTCAGATGTGCTAATCGTCCATGTTCTCATAGCCG
AGGCGGCATTACGCCAGGAGGAGAAGAAGCCCCAGTATTGCCTTTCCCTCCTTCAAATCGTCTCCTCCCAACCACTTCCA
CTCAAGACGCGCCTCGCCGCCGCACTTTGCTTCAAGAATTTCATCCGTCTAAACTATGTCGATGAAGAGGGGTCCTACAA
GCTGCCTCAGGAGGAGGTCGGCACCATCAAGCAGGAGCTCGTGGGGCTCATGATTTCCTCACCACCAAACATCCAGACAC
AGCTCGGCGAAGCCATCAGCATCATTGCCGACTCCGACTTTTGGAAACGCTGGGATACGCTGATCGACGACCTCGTCAGT
CGCTTGTCTGGGTCTGATCCCAAGGTCACAAACGGCGTCCTTGAAGTTGCCCACTCCATTTTTGTCCGATGGCGGCCACT
TTTCCGATCCAACGAGCTGTTTGAGGAAGTCAACCATGTGCTGTCAACCTTTGGAGAGCCATTCATGCGCATGCTCAACG
TGGTAGACCAACAGATCGATGCCAGCAAGGATAGTCCAGAGGTTCTGAAGACCTGGTTCGAAGCCCTGAGCCTGTTGATG
AAGATTTTCTACGACCTGTCCTGCCAGGACCTGCCGCCTATCATCGAATCCAACCTCCAGCCAATCACTGCCCTCTTTCA
GAAATACCTTTCCTATTCCAACCCAGCCCTGGCTGCCGATGACGACGACGATCCAACGGTAGTAGAGAACGTCAAAGCGG
ACGTCTGCGACGCACTGCAGCTGTACACGACTAAATACGACGACGATTTCGGCGCGCACACAGAGCCGTTTATCCGCTCT
GTGTGGGACGTGCTGTCATCTACGGGTCCGGGGAAGAGATACGACACTCTTGTCAGCAAGGCTCTGCAATTTTTGACTGC
CGTTGCCTCGTCCCCGCGTCACGCCGCAGCCTTTGACTCGGAAGAGACCCTGGGTCGCATTGTTGAGGCTGTTATCTTGC
CAAATGTGGCGATTCGCGAATCTGACATTGAGATGTTCGAAGATGAGCCGATTGAGTTCATTCGCCGCGACTTGGAGGGG
TCTGACACCGACTCGAGAAGACGGGCGGCAACGGACTTTTTGCGGAAACTGCTGGAGAAGTTCGAGATGCTCGTGACCAA
GGTTGTGTTCCGTTACATTGACCACTACCTCACTCTGGGCAAGACGGATTGGAAGGCAAAGGACACAGCCATCTATCTGT
TCCTGGCTATCGCCGCCAAGGGCGCCGTCACGGCAGCCCAAGGCGTGAAGACGGTCAACCAATATGTCGATGTCGTAGAT
TTTTTTCAGAAAAATGTGGCGCAGGACTTGCTCAATGGCTCCGACGCAGAGCCGATTGCCAAAGTCGACGCCATCAAGTA
CCTCCACAATTTCCGCAGCCAACTGACAAAGGAGCAATGGCAAGGTGCTTTCCAACCTCTGATTCAGAACCTCGCCTCGA
CGAACTACGTCGTGTACACATATGCGACCATTGCTGTGGAGCGGGTGCTGTTCCTCACCAACGATGCCGGCGTCCACCTG
TTCGGACGTGCCGATATCGAGCCGCTTGCAAAGGATCTCTTGGATCATTTGTTCGGCTTGGTGGAGCGTGATACCGCCCC
TGAGAAGCTGCAGGAGAACGAATTTCTCATGCGCTGTATCATGCGCGTTCTCATCGTCCTCAAGGAAGGAACTATACCCA
TTGCCGATGGTGTTCTTCTCCATTTGGCCAAGATCACTAAGACGATCATGCTGAACCCGAGTAACCCGCGTTTCTACTAC
TACCATTTCGAGGCCATAGGCGCTCTTGTACGGTATTGTGGCGACAGCGTGGGGACGAAGCTGGAGGAGCAACTCTGGGA
GCCGTTTTCGTTCGTTCTTAGGGAGGACGTCACAGGTACGTCTTTCTTGTATTACGCTTTCTGTTCCTTTCGCATGATGT
ATAGTGAAACTGACTTCCAAAGAATTCGTACCTTACGTCTTCCAGATCCTCTCAGCGCTGCTTGAGGCAAGCCGAACAAA
GGCTCTATCGGATCATTACAAAACTTTACTACCCATCGTCCTGGCACCGACAATTTGGGAAACAAGAGGAAATGTCCCTG
CGTGCGCTCGATTCCTGGCTGCAATCTTGCCCAAGGTGGCAGATGCCATCGTGGCCGAAAATCAGATCGAGCCGGTCCTA
GGCATATTTCAACGGCTCTCTGCCAGCAAGAAGACAGAACAGAACTCCATTGACATTCTTGAGGCCGTTGTAACCTCTCT
TCCACCGTAAGTCACGAGTGCCCGCTACAAGTGCATGTTAAAAGGAGAGTATCTATGCTAACATTTTTCAAAGATCATCT
TTGGACCCATTCTTCGGCACCATTTTGACCCTCTTGTTCACCAAGCTGCAGAACAACCCATCGGACTCGTTCAAGATTCG
GTTCGCGCGGTTTTACCACTTGGTATCCGGCAAAGGTGTCGAAGCAGGCCTTGGTGCAGACTACTTTATTCAGCACGCAG
AGGCACTCCAAGCCGGTGTCTTCACGCCAATCTACCTCACCATCATTCTGCAGACAACAGGCCAACTAGCACGGCCAGTG
GACCGCAAGCTGGGAGTGATTTCCTACACAAAGACGCTGTGTGACAGCAAGGCATTTGCCGAGCGGTACCAAAAAGGCTG
GGGCTTCACATGCAACCATTTGCTGGATCTGCTGAAGAACCCGCCCCAAGTGACAGGCGGTATCGGTGACGAGGTTGTCA
ACGAGGCAGATGTGGACGACATCGGGTTTGGGGTGGGATACACGCCGCTGAACACTTGCAAGCGAGGCCCCCGAGACGAC
TTCCCAGAAGTGGAAAACGTGCAGCAGTGGGTAGGCACATTCTTCAAGGAAGCAGACAAGCGGCACAATGGCACCATTGC
CGGATTTGTGAACAGCCGGCTGCAGCCAGAGGCACAAGAAGCCCTCGCCCCCTATCTGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62