GenePrediction:GLEAN_4655 Details

Name: GLEAN_4655
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1200897..1199965 (- strand)
Length: 933
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1200897..1200855 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_167:1200751..1200537 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_167:1200405..1199965 (- strand)
Length: 441
>GLEAN_4655 class=GenePrediction position=GCSC_167:1200897..1199965 (- strand)
ATGGCGGACAGATTCCCATCTTTGGAGGACTTTGACTCTGGTGGTATGCATCAAAGAACTGCCCTCTCCCTTGTCTGGCA
GCCTGTTTCTCCGCTCTTCTTTTTCAATTTCTGCGTGAGATGTCTGCTAACGCAAGTCTACTGCAGCCCAGACGGACATC
AAAAATGCGTCGCTAGAGGCGACTAGCGACGACTTCCTGGCCCGCGAGCGGGCCATTCTCGGCGACGATGCCAACCAGTT
TGTGACGGCTGCCGATACGGCAACATTTTCGGCTGACGACGATCTGCTGGGAGGTGATGGTGATGCTGCAGAGGCGACCC
AGTTTGAGAGCAGCTTCCCGGACCTATCCGCTCAGAACCAGGTAAGAAAAAGAAGAAATAAGGAAAGGAAGAGAGAGCGA
GAGAGCGAGGTGGAGAGAGAGAGAGAAAGAGAGAAAATGAGAGAGAAAGAGAAGGACAGAAAGGACAAATACTAACAAAC
CGCCGAGGACAGACGACGACATCGATCACGGGCCCTTCATTGGATTTCAAGTCGGGCTACACGGCTACAGTCGAGGACGA
GGAGGAGCCCGAGGTGATCCGGGCGTGGCGGCAGCGGCGCGACGAGCAGAACGCCAAGCGGGCGGCGCAGTTTGCGCAGC
AGCGCGCCGAGACCGTGGCCGAAGCGCAGCGCAACATTGACGACTTTTACGACAACTACAACAACAAGAAGGACAAGGTG
ATTGGGCAGACGCGCAAGGACGCCGAACAGTTTCTGGCCAACCGCGACGACGTCACCTCGGGTGGCACCAGCTGGGAGCG
CATCGCCAAGATCGTCGACGTCTCCGGCAAGGGCGCCAAGGGCGGCGCCTCCGGCTCCGGCAAGGAGCGCTTCCGTGAGC
TCCTCGTCAGCCTGCGCAAGGACGAGAAAGCGCCGGGCGCCGAGGGTTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62