GenePrediction:GLEAN_4656 Details

Name: GLEAN_4656
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1197260..1195531 (- strand)
Length: 1730
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1197260..1197122 (- strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_167:1197046..1195698 (- strand)
Length: 1349
Type: CDS
Source: GLEAN
Position: GCSC_167:1195626..1195531 (- strand)
Length: 96
>GLEAN_4656 class=GenePrediction position=GCSC_167:1197260..1195531 (- strand)
ATGGCCGCACCGCCGCCTCCACCGCCTCGCGGCACAATGTCGCTGTATGCAGAGCTCCTGGGAGGCCCTGCTGCCGAGCC
GGTTGCAGCTGCACCAGCATCAGACGCAGCCGTGAAACCGTCTGCGGCAAAAATTCCAGGTGAGTTCCATCTTCCTTCTT
CCGTCTTCTGTCTCCATCTCTCGTCTGCCCTGCCCGCCTGCTGACCCTCGCTAGCACTCCGCTTCCAGCCCATCATTCGT
CGGCCGCAGCAGAAGCCCAAGGCCACCGGCCACCGGCTCAAGTCCCTGCCCGTTCCCTTGTCCGCTGTACCGGCCACGAC
GACGAAGACGACTTCTGTCACCCACACCGCACGCCCGACGCTGGCCGACTGGGCTGCCGGTGCAGACGATGACGAGTACG
ACAACGATCACTACGATGACACCAACGACAATGGCGGCCCGCGGCCGTTGCGTGGTGGCCGCAAGCGCAAGAAGAAGCGC
CCCGACGAGAAGCAGCAGCAGCCTCATCGGCGGTTGGGCTACGGCGACATTGACTGGGACGAGCTGTACGACCCGGCCCG
TCCAACCAACCTAGAAGCCTATCTGCACAGCGACGAGTGCGTGTCCGCTGTGCGCGACTGGAAGGCCGTCCTGTATGCAC
ATCGGAGGCGGCTGCGCCGCCAAAACGACGACGACGACGACGACGACAACAACAGCGACAGCTCCGACAGTCACGACAAC
CACCAGTTTAACAGCGCCTTCGCGCCACCCGCCGCGTTTGCCCCGCCGCCGAGCCTGACCACCGGCTCCGGCTATCCAGC
GCCAACAGCAGATGAGGCTGCAGCTGCACATCCAACGCTGTCACACCCACAACCATCAACACCACTGCCACCACCACAAT
CACTTCCTCCGCCGCCACCGCCGCCGCCATCGGATCCCGCTGTCCTTGAAACCACCGCCACGCCAGCTACAGCCGTCCCA
ACTCTAGCTGACGGTCTCATCATCTCGCGGGCACCAGTTCGCTTCAACACCACCACCACCACCACAAACGGCATTAAAGG
TCCAGACAACGACGACGACGACAATACATACGAGCCGCCACCAGCATCTGCCGACGACGACGAAGGCGGTCCCTCGTCCT
TCTCGTCGGCCCGTCCAGGCCAGGCTGGCTTCGCCGCCCGTCTCATGGCCAAGTACGGCTGGACAAAGGGTTCTGGCCTG
GGAGCTGACGGCGGCGGCATCCTCAACCCACTCCGGCACAAAAAGGTCGGAGGCGCCACCAGCGGCCGTGGGCGCATTGT
CGGTGGTGGTCGTGGTAGTCGTGGTGGTCGTGTCGAGGCTCGTGGCGGCGAATCAACTGAGCTTCAAAGTCACGTGACCT
CTTCCTCGCCCTCCACCGTCGTCGTCCTCCGCAACATGGTCGAGGGCATGCCAGACCTGGCCGCCGAGATCGCCGACGGT
CAGCTCGTCCAGGAGATCGGCGAGGAGTGTGGCGAGCAGTACGGCCGCATCGAACGCGTCTACATCGATGTGCCCTCCAA
GCTCGTCTTTATACAGTTCACCGACGCTGTCTCGGCCTTGCGCGTAAGTGTCCTCGCTTTCCTTGCCTTTGTCTCTTACA
GTCTCGGGCTTTCTGACTTTGTGCTCCAATACAGGCTGTTACTGCTCTTGATGGGCGCATTTTCAACGGCAACGCCATCG
CCCCAAGCTTCTACAACGCTGACAAATTTGACCGAGGCATATACGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62