GenePrediction:GLEAN_4657 Details

Name: GLEAN_4657
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1186391..1184995 (- strand)
Length: 1397
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1186391..1186384 (- strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_167:1186316..1185697 (- strand)
Length: 620
Type: CDS
Source: GLEAN
Position: GCSC_167:1185631..1185584 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_167:1185520..1185440 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_167:1185359..1185225 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1185143..1184995 (- strand)
Length: 149
>GLEAN_4657 class=GenePrediction position=GCSC_167:1186391..1184995 (- strand)
ATGAAGAGGTGAGTTCAGCAAAGCAGTGAACACAGAACGCCGCGTGCTCAGTAATACTGACAGCATGATCTGCAGCTTCT
ACTGCTGGGGACCGTCCAAAGCCCCAATGGACATGACGCTCAATGAACAGGCGTCCTGGAATGCCCGTCTTCAAACGCCC
GTTATCTTCAACCACCACGCCCCATTAATCGTCAACTCGACAGTAGAGCACATCAACCTCAACCCCATCCGATCCACTCG
CAAGGCTGTCGCGAATGAAGAACATGTCCTTATCCTAACACCTATCAAGGATGCGGCTCCATACCTGTCCAAATACTTCG
AGCTCATCGCAGAGTTGACTTACCCGCATAACCTCATCGACCTCGCATTCCTCGTGTCCGACTCTTCCGACGATACACTC
GCTGTTCTTGCTTCTGAACTTAACCGCATCCAGAAACGTCCCGATCCGTTTCGAAGCGCCACTGTAGTGTCGAAGGATTT
TGGCTTCCATCTGAGCCAGAACGTCGAGGACCGGCACTCGTTCGAAGCCCAGGGGCCTCGGCGCAAGGCTCTAGGACGTG
CACGCAACTACCTGCTTGCTACTGCCCTTAAACCTGACCATGCATGGGTTTACTGGCGGGACGTTGACATCGTCGACAGT
CCCATTCATATCCTTGAGGACTTCATTGCTCATGACCGCGACGTCCTTGTCCCTAGTGCGTCCTATTGCCTTATGTATGG
CTGCTGCGTTCCACTATTGAGCTTGCTAACACGAAGTTAGATATTTGGTTCCACCGGTATAAGGATGGCCGTGATATCGA
GGGCAGATGTAAGACTCGCACGATACACTTCACCTGACATTTATGTGACTGGTATTAACAGTCTATGATAGTTGATTACA
ACTCTTGGGTTGAGTCCGACAAGGCCCGCAGACTGACAGCGAGCCTTGACAAAGATGTCGTACTTGCTGAAGGTATGGAT
CTTACGCCTGTTTGACGCTACACCCGGCACGCTGCTTCACAGCGATATGCTTACCAGACCTATGTACAACAGGATACAAG
CAGTATGACACCGGCCGGACTTACATGGCACGGATAGGCGATTGGCGGAACGACAAGGACGAAGAAATGGAACTTGATGG
CATCGGCGGCGTCAACATTCTTGTCAAGGCGGACGTACACAGATCTGGTATGTGATTTTGACATCAAGGCTCGCATTCAT
GACTTTCCTTAGTATGAGAAAAGGATTATTGACTAATTGGCTGTACAGGAATCAATTTTCCATGCTACGCCTTCGAGAAC
CAGGCCGAGACGGAGGGCTTCGCCAAGATGGCCAAGCGAGCAGGATATGGTGTCTATGGCCTTCCCAACTACGTTGTCTG
GCACATCGATACCGAGGAAAAGAGCGGCAACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62