GenePrediction:GLEAN_4658 Details

Name: GLEAN_4658
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1182395..1181824 (- strand)
Length: 572
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1182395..1182310 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_167:1182212..1182157 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_167:1182087..1181930 (- strand)
Length: 158
Type: CDS
Source: GLEAN
Position: GCSC_167:1181865..1181824 (- strand)
Length: 42
>GLEAN_4658 class=GenePrediction position=GCSC_167:1182395..1181824 (- strand)
ATGGCATCCACATCCGCGCAGTCAGAATGGCTCGTCATAATCCCCGACTATCCTGGCACGGTGGACAAGCGTCTTGAGGT
TCGAGGGTTAGTGATCCGTGAGAGCGGTGGCAACAGACGTGAAATGGTCGTGTCTCTGTATCGACTATACGTGGTTAGGA
CATTCTGACCAAATACTCTTTAGAATCCACCTGGCAAACACTAAACCCCTGCGGGAGTCTGGTGTCCTGAAGTCTGGAGG
TAGGTCGCTCATTGAGGCCCACTGATTTACCTCATCTTTCCGCTTGCTAGTACTAAAGCCTCTTCCAGGCGCAATCGTGG
ACGACATTCCGTCTAACCCAGCTGATCCCACTACGTATAAGTTTGCTGGCAGCACTCTCACTGTCGTGGCGGAGTCGCGC
AACGATGTTGTTGATCTGATCAAGAAAGACATTTACACGGAGAAGGGCGTGTGGGATGTTGAAAAGGTATGTGCTTATAG
CCTGTGTGTGGGACCTGACTTGTTACGAAATGCTTCTAACTACGGCACAGGCTCAAATCTATTGGCTGAAATCTGCTTTC
CGTGATCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62