GenePrediction:GLEAN_4659 Details

Name: GLEAN_4659
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1178987..1178319 (- strand)
Length: 669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1178987..1178919 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_167:1178825..1178751 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_167:1178562..1178430 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_167:1178365..1178319 (- strand)
Length: 47
>GLEAN_4659 class=GenePrediction position=GCSC_167:1178987..1178319 (- strand)
ATGTCTACTGCTGAGCTTGCGACGTCCTACGCGGCGCTGATCCTCGCCGACGATGGCGTTGAGATCACGGTTCGTGCCCA
CTCCCCGATCGCGAAAAGAGGATCTGCAAGACATTGCGCAAAAGGACGGGAAATACTGACAGGAATTTTCCGGATTATAT
AGGCCGACAAGCTGCAGACCCTGATCAAGGCTGCCACCGTTGAGGTCGAGCCGATTTGGACACAGCTCTTTGCCAAGGTA
CGATAAGTTTGCGACACGCCTTTTGATATTCGGGAGTCAAAGCACAGAGACATGGCAGCAAAAGGAAAAGAGGACTGGCA
ACAGCACAATACTGTCCCCGGACTGTCTCCGAATTCCAACTCGAGCTCAGCGGCGTTGCATAGGGAAAATATGGAACCTG
GTTACTGACAGTCGTTCCGGTATAGGCACTTGAGGGCAAGGACGTGAAGGACCTGCTCTCCAACGTCGGCTCCGGTGGCG
GCGGTGCTGCCCCGGCTGCTGCTGCTGGCGCCTCTGGCGCTGCCGCCGCAGAGGAGGTTGTCGAGGAGAAGGAGGAGGGT
ACGTATCGTCACGGCAGCTTGTCCCCCGACTCCACAGAAATCGCAACTAACAACCACAACAGAGAAGGAGGAGTCCGACG
ACGACATGGGATTCGGGCTGTTCGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62