GenePrediction:GLEAN_4660 Details

Name: GLEAN_4660
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1175769..1174382 (- strand)
Length: 1388
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1175769..1175730 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_167:1175562..1175469 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_167:1175378..1175320 (- strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_167:1175237..1175122 (- strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_167:1175051..1174929 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_167:1174867..1174382 (- strand)
Length: 486
>GLEAN_4660 class=GenePrediction position=GCSC_167:1175769..1174382 (- strand)
ATGTCTGTCTACATCCTACCAGCAGAACTCGGCTTCCGCCGTACGTTGTCCCATATCCTCCCAGCTTCCAGTTCCAACTT
CGCCTATATGTTCGCCCTCATTTTGCTTCTTTTCCGTATACAAACGGAATGGACATTCTATACCAGAATGTTGTGATTGG
GAGCGGTTATATGAGACCGTGTAGCTGATGTTCTGATCTGCGAGCAGGTCCTTTCACGGTCGAGGTTTCGGAAACTTTAA
CGATCAAGAACACGACCCCCTTGCCGATTGCTTTCAAGGTCAAGACGACGGCGCCGAAACAGTACGCTCATTACACGTGT
TCTTTTCCCCCGCGGATGCCATAAACGTCGCCGGGCCTGCCTGCTCATCTGCTTACCTGTTTTCTCTCTAGATACTGCGT
TCGACCAAACTCGGGACGCATTGAGCCTGACCGCTCCGTGGAGGTGTCTGGTAAGCCGGCACTCCTGTTTTACCTGTACC
GACATTGACACTCGAATACCGAACGGCTGTTCTGACATTTCCTTCTTTCTAGTTCTTCTCCAGGCAATGAAGCAGGACCC
TCCTGCGGATTACAAATGCCGGGACAAGTTTCTAGTGCAATCCATCCCCATCACAGGCGACAAGGAATTCGTCTCTGTCC
AGGAGATTGTACGTGCCCCTCCTCCCCCAACGATCAGAGCCCGAGGCCCGTATGCTGACAATGTTCTCACGCCGACAGTG
GGACGGTGTTGAAAAGTCTGCGATCCAGGAGAAGAAGATTCGTGTCAACTTCTTATCTGCTGAAGGCACGGCAGAGCCCG
AGGCAGTCACGCCACAGCGCTCTGTCCCCACGAACTACCCGGTTTGTTAATCCACTCTCGCCTTTTCCAGTCTGTCTTGC
TGACTCGCCGTGCGCTGGCTAGGATGATTCTACTTCTGATGTTCCACCACCTGCTTACGGGTCTCCCAGCGGGGGAGACT
CCTATGGGGCCAGCAACACGTCTGTCACGGCGGAGACCCCGGATAACAGAAGCGGAAGCAAGAAGAATCTGGAGTCCGTG
TCGCCGCCATCGGCGTCAAGTGGCACGACGGCAAACTCTGGGGGTGCATCTTTTGCCCCTGGCGGAGTTCTGTCGGCGGC
TACCGCCTTGACAGCATCAACGGAGCACAAAGAGGTTACGATTGCGTCGCTCAAGGCGAAGCTTGCCGAAGCCAATGCGC
TGATTGCCTCGCTTCAGGACGGCGGTCTGCGCCAGAGAAAGGCAGCAAGTACGGCAAACCCGACCGACAGTACTACAGCA
GAGACAGCGCAGTTGGGCCAGGTCGTTCATGGCACAGAGGGAGTACCGGTTCAGATAGTTGCCATACTGAGCCTTATGTC
CTTCTTGCTGGCCTACTTCTTTTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62