GenePrediction:GLEAN_4661 Details

Name: GLEAN_4661
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1171748..1170413 (- strand)
Length: 1336
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1171748..1171537 (- strand)
Length: 212
Type: CDS
Source: GLEAN
Position: GCSC_167:1171468..1170802 (- strand)
Length: 667
Type: CDS
Source: GLEAN
Position: GCSC_167:1170610..1170413 (- strand)
Length: 198
>GLEAN_4661 class=GenePrediction position=GCSC_167:1171748..1170413 (- strand)
ATGGACCTCGACAACAGCACGACGCCGGAAGAGATCCCCGACCATCCGCCGGCCGGCCAGGTTCCGCGAAACCCCACCCT
GTTCTACTGCAGCGCGCCACGCTGCGGCAAGTTCTTTAACCGCAAAGAGCACCTGACGCGGCACATCCGATCATCGCACA
GCTCGCAGCCCAAGCACGAGTGTCCGATCTGCGGGCGACGCTATGCGCGCAGGTAAGACACGGCGAGTGTCTCATCGATC
CGTGTTCACGATCAGACTTATTGACAGAGCCGCCACGCAGCGATGTGCTCAAACGCCATGTCGAGAACCACCCGCAGAAT
CCGCATCCGCGACAGCCCCGACTCTCGCCCTGCAGCGGCTGTGCAGAGCGCAAGACCAGGTGTGATGCGGGCATTCCGTG
CCAGCCGTGCACCCGGGCACACACGGAGTGCATCCGCTGGACGGCAGGGTTGCCCGAAACGGCCGTTGCTGGGACGCAAG
CGGTCCTCTGGGAAGACGGCAATGACAGCAATCAACGGCAGCAGCAGCAACAGCAGCAACAACAACAGCAACAACACTCG
CCATGGTCACTGCTACCGGGCGTCCCGCTTCAACACCAGACTGTGCACACGCCCGACAGCGGCCTGGGCCTGGGCGCCAC
CCAGCAGCAGCAGTCACAGAGCTTTGCGTCTTCCGGCTCACCAAGCGCCCCGGCCGACCTCTCGGGCCTCGACCTGCAGA
CACCATACGATCCCTCGGCGCTGCAGCGGCTCATACAGACGTATTTTTCGGTAGTTCATCCGTTATGGCCCATCCTGCAC
CGGCCGACATTTCGTGTGGACGAGTGCAGCCCACTGCTCCTCAAGAGCATAATACTGCTGGCCAGCCTGATGGAGGATGG
CTATGAGCATTCGAGCATGGGCCCCATGGTGTTGAGCTCCGTGTTTGCCTCCCAGCTTATCGGCGACGTATGTGTATGCC
TCTTCGGGCTTGAGCCGCCGGCATGGTTGCTGACTCTACGTGCAGGAGCAACATATCCCCATACAGACACTGCAGGCGAT
GTTGCTGTGCATCGTGTACTGTGTGACGAAAACGGCAAGGTTCTTTCCTTCCCTAGGAAGAATAGCAGAGTCGGAGCTGA
CGGACATTTCTCGCACAGGCCTGTAGTACAATGCTGTTCCGCGGGCTGTGTCTCAACGGTTACTTAATCGCGGCCTGCCG
ACACCAGCAGATACTGAGCGGCCGTCATGAGCACCCCGGACTGCAGGACAAGGACGCACTCGAAGTGTGGCTCGCGCAGG
AGGAGCGCAACAGGCAAGACTTGCCGGCGAATGACTGGACTGCGGGAGTGTGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62