GenePrediction:GLEAN_4663 Details

Name: GLEAN_4663
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1167802..1165973 (- strand)
Length: 1830
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1167802..1166197 (- strand)
Length: 1606
Type: CDS
Source: GLEAN
Position: GCSC_167:1166124..1165973 (- strand)
Length: 152
>GLEAN_4663 class=GenePrediction position=GCSC_167:1167802..1165973 (- strand)
ATGAACTCTCTCAACATCCTCTCTTCGCATATTACGCCCTCAACCAGTCCCTCTCCATCGCGATCCAATTCGATCTCTGG
TCTTGGCCTGGTCGCGCCCGAAATCGGTGGTGCGACAGCCAACGGAGACACCGGTAGCGGACACAGTGGCTTTTTGGCTG
ACCGAAACAGTACGGCCACTACGCCCGGAACAGACGCCTCGCACTACCTCGGCCGGCCATCACCGGGCGACAGAGCTGAG
CGCGGCGCCAATATCGGGACCGCCTTCTCTGCTGAATGTGCCATGGAGGAAACCACCCCGCTTCTATCACAAAAGGATAT
CCATGAGGGTGTCAGCAGCACCGGCCATGTGCGACTGTCAAAGTGGCGTGCCCTGCCCGAACAGATAGCCCTGACGGTCT
GGCACTCGATCCGCTGGATGCTGCAGACCCTGGCTGCTCCTGGAGCATATCTGCTGGCCTTTCTCTGCGACGACCAAAAC
GGCTTCTCGCCGCTCGGTGCAGCCAGGATTCTCTTTCAACGTCCTCGGCCTTCGCCAAGCGACCCGCTCGGCAAGATGGC
TGCCCGATTCGACGGGGCCGAACGAGACTATACGTTGGACGAGAAAGTATCAAGACGGCTGTCGACCGACAGTGAGGACG
GCTCCATGGCCACCTGGTCGGCTCGCGGCCGCTTCCCCAAGACGCCTTCCTCTACGCTAGGCGTGAACGCGTACGCGGTG
TCGTCCGAATCCGAATCCGACTTTGATCGCAGTCGCGTGTCCGGACGAAGCGGACAGGGACCCCGGAGAAAAGGAGCCAG
CGACAGCACCGGCCGGAGAGGAACAGTAGGAAGCCGCTCTGGGGCTGACGACGACTTGGCGGCCAACTCGGTTGCAGGCC
GGCGGTCAGTCCGCATAAAGCTGAATGACGACACGCTGAAGGAGCGGAAGCACCGCCGAGGACAGTCATCGATGACGGGG
TCTGCGCGTGGTGGCAGCAGCAGCGACAACTTCGGCGGCAGTGCCGGGAGCAACGGAAGCGACGGCCCGGCCAAGGACAT
CTCAGCACAGCTCAAGTCGCCCACGTCGCCGGCAGGAGCCCTGACAAGATATCCGCGCACACCGGCGCCGCCACGGCCGC
TTCTCCCGCAGCGACAGCCGTCGTTTCTGAACCTGGAGACGGCCGATCGGACACACCAGAAGACGCTCATCCTCGACCTG
GACGAGACGCTCATCCACAGCATGTCCAAGGGCGGCCGCATGAGCACTGGACACATGGTGGAAGTGCGGCTCAACACCAC
GTTTGTCGGCATGGGCGGACAGCCGAGCGCTGGGCCCCAGCACCCGATCCTCTACTACGTGCACAAGCGGCCGTATTGCG
ACGAGTTTCTGCGGCGGGTGAGCAAGTGGTACAACCTGGTAGTCTTCACAGCCTCGGTGCAGGAGTATGCCGATCCGGTC
ATCGACTGGCTTGAGTCGGAGCGCAAGTATTTCTCCGCCCGCTACTACCGCCAGCATTGCACGTTCCGGCACGGGGCCTT
CATCAAGGACTTGAGCGCGGTGGAGCCCGACCTGAGCAAGGTCATGATCCTCGACAACAGCCCGCTCAGCTACATGTTCC
ATCAGGGTGAGTTCTATGTTTTCTGTTTTGATTGTTTGGACTCTTTTCTCCCCGTTCCTCTGCTGACAACAGTCTCAGAC
AACGCAATCCCGATCCAGGGCTGGATCAGCGACCATACCGACAACGATCTGCTGCATCTGGTCCCTCTGCTCGAGGGGCT
CCAGTATGTGTCGGATGTTCGCGCGCTCTTGGCACTGCGTGGCGGCGAGGACGGACGGCACATGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62