GenePrediction:GLEAN_4664 Details

Name: GLEAN_4664
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1164897..1164314 (- strand)
Length: 584
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1164897..1164885 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_167:1164821..1164753 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_167:1164684..1164314 (- strand)
Length: 371
>GLEAN_4664 class=GenePrediction position=GCSC_167:1164897..1164314 (- strand)
ATGTCTCTGCAGTGTAAGTCTCATACTCTCGGACCGTCCCACTCTGAGATATGTCCCTGACCAAGATCAACAACAGACCT
TCCCTCTGTCAAGCCCTCGGCCATTGCCCTGGGCACAGTCTTCAGCCAGACTGCCGAGCTCGTTCGTAAGTGCTATAAGT
CTTGCCACATCCATCGATTCTGCTGCACGCCGACCAAGTCTAACATCTGGCAGTCCTGCAACCCATCTTTGGTGAGGCTT
ACCGCCGTGCCAAGGACTCCCACAGTGCCGAGGAGTTTGTCCGCTCCAAGCAGGCCAGCTCAGCTGCTGTCGCCTGGGGC
ACCACCTTTATCGGCTCCGGCCTGCAGAGCTACGGTGTTGGTGCCCTCATCAACGCCACCGCCACGCTCTCGTACAAGGG
CTCAGCCTACCTGGGAGCTCTGATCTTCCTGGCTACCAGCGCGCCGCAGTACGTGGCCGAGGTCCTGACCGAGCGGCGGC
CGTGGGACACCGTCCTGGCCAGCGTGGCCGCAAAGCTGGTCGAGACCGTCGGACTGGCCACCTTCCTCACCTGGTGGGGA
ACTCGGACGAACCCGTTTGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62