GenePrediction:GLEAN_4668 Details

Name: GLEAN_4668
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1133823..1133484 (- strand)
Length: 340
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1133823..1133791 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_167:1133721..1133619 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_167:1133557..1133484 (- strand)
Length: 74
>GLEAN_4668 class=GenePrediction position=GCSC_167:1133823..1133484 (- strand)
ATGGCGTCCAACAACGACTCCTCACCGCCTGTGGTGTGTCCAGAGAATCATGGCCGCTCGTTGTCCCCAAAACAGCTTGC
TAACTTTTTTAAAACGGTGCAGTCAACTGAAGATGCACGTGCAGACTTGACTGCCCAGATAGACGATCTGCTTAACACGC
TGTCGAACAAGTTTGCCGGTGTCTCCAGCGAGATCTTTGCCAAGAGTCAGTCGCTCCCCTCTGTGCTGTTGCTCTATATG
TGTGTTTTGGATGCTCACACGTGCAGTGGACGAGATGTCGCGGCGGCTAGACAACATCGAGGCTTCCATTAAGAGCAAGG
AGGATGCGTCAAAATCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62