GenePrediction:GLEAN_4669 Details

Name: GLEAN_4669
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1131609..1131189 (- strand)
Length: 421
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1131609..1131548 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_167:1131465..1131189 (- strand)
Length: 277
>GLEAN_4669 class=GenePrediction position=GCSC_167:1131609..1131189 (- strand)
ATGTCTCACGAATCCGTCTGGAACTCGCGCCCAAAGAAGTACGGCAAGGGCGCCCGGTCTTGGTAGGCAGCATCTCCCCC
CAAACGAAGAGGGGGACAGACATCGCGTCCTCCAGCAACCTGCAGCATTGCTAACATGTGGCAGCCGTGTCTGCGCTCAC
CGCGCCGGTCTGATCCGCAAGTACGGTCTCGACATCTGCCGTCAGTGCTTCCGGGAGAAGGCTGCCGACATTGGCTTCGT
CAAGGTAAGGACAGCAAGCCGAGGAAGTGACAAGAGATGGAAACAACGATGCACGTGTACTGATGGTTCGGACAGCACCG
GTAAATGCAACAAAATCGAAAGCAACCAAAAACCCCGCGCACGCCCTTCTTTACCTAGGCGATCCCGAAAACGAGCAATG
GCGAAGGGGGAGTTTTTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62