GenePrediction:GLEAN_4670 Details

Name: GLEAN_4670
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1114494..1112987 (- strand)
Length: 1508
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1114494..1114451 (- strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_167:1114359..1114280 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_167:1114109..1113387 (- strand)
Length: 723
Type: CDS
Source: GLEAN
Position: GCSC_167:1113327..1112987 (- strand)
Length: 341
>GLEAN_4670 class=GenePrediction position=GCSC_167:1114494..1112987 (- strand)
ATGGCCGAGCCTATCCGCAACAAGCGGCCTGACCCAACCGCCCCGTACGTCGCTGTCATCGTTTGATATTTCTTGTTTCT
ACTCTTGCGTGCATATTTTATCCCATGCACATCTTATCTGACCAGCCCGTTCCAGGACACCGCAGAACACCCCCGCCAAC
AATGCCCCCATCTCGTCTCACGCCCAGCAGCCTGGTGTTGCCAGCATCTCCGAGGGTCAGTCCCCCGCGCACTCGCATTT
TTCATTCTCCATATTCCATTCTCCATGGTGCCTGGTACACGGCGCGGACACAGCGTGTGCACCATGTCCGCGCCGTTGTC
ATGGTCCCCGGACTTGAGGATCGCGACCCGGTGCTCGCCCAGCTGAAACTAACCCCTACTTACAGAGACGGTTGATATCG
CCGCTGCCGCTTCTCTCTTCGCGCAGAACCCTCGGCTCGTTCACATGATCCAGGGCAAGCTCGGCAGCCTTGTCGGTCGG
TCGTCCGGCTACATCGAGTCACTTCCCCCCCAAGTAAAGCGTCGTGTCGCCGGCCTGAAGGGCATCCAGAAGCAGCACTC
GAAGCTGGAGGCCGAGTTCCAGGAAGAGGTCCTGCAGCTAGAGAAGAAATACTTTGCAAAGTTTACCCCGCTGTACGAGA
AGCGCGCCACCATTATCAACGGTGGCAACGAGCCGACCGAGGATGAGGTGGCCGCTGGTGAAGAGGATGAGGACGAGGAT
GAGGAGGAGACTGAAAAGGCCGATAAGGCTACCGAGGCCGCAGCCGAGTCCTCAGAAACTATCTCTGGCATTCCTGAGTT
CTGGCTGTCCGCCATGAAGAACCAGGTGTCGCTGGCCGAGATGATCACCGACCGCGATGAGGGTGCACTCAAGCATCTTA
CCGACATTCGGATGGAGTACCTCGACAAGCCGGGCTTCCGCCTGATCTTTGAGTTTTCCGAGAACGACTACTTTACCAAC
AAGACCATCTCCAAGACATATTTCTATCAAAACGAGTCGGGCTACGGCGGTGACTTCATCTACGACCACGCTGAGGGCGA
TAAGATCAACTGGAAGGCGGATAAGGACCTGACCGTCCGCATCGAGCAGAAGAAGCAGCGCAACAAGAGTGAGTGTTGCG
GTCGCCGTTACGGGAGAGAGCCCGTTGCATGCTGACCAGATACACAGACACAAAACAAACCCGCATCGTTAAGAAGACCG
TCCCCACCGAGTCATTCTTCAACTTCTTCTCGCCGCCCAAGCCGCCCGCAGACGAGGAGGATGATGCCGCTTCGGATATC
GAGGACCGTCTGGAGCTTGACTACCAGCTTGGTGAGGACATCAAGGAGAAGCTGATCCCGCGTGCCATCGACTGGTTTAC
GGGCGAGGCACTCGCCTTTGAGGAGATGGACGAGGACGACATTGAGGATGAGTTTGACGAGGAGGAGGATGAGGACGATG
ATCTGAGCGAGGACCATGACGACGAGGACGAGTCCGATGACGACGATGTAGGTGCTCAGCTCACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62