GenePrediction:GLEAN_4671 Details

Name: GLEAN_4671
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1111671..1109965 (- strand)
Length: 1707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1111671..1110546 (- strand)
Length: 1126
Type: CDS
Source: GLEAN
Position: GCSC_167:1110478..1110369 (- strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_167:1110302..1110201 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_167:1110131..1110050 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_167:1109993..1109965 (- strand)
Length: 29
>GLEAN_4671 class=GenePrediction position=GCSC_167:1111671..1109965 (- strand)
ATGAGTTCAGCCCAAGACATTGCCAGGCGGCCGGGTGCCGTGACCACCTCTGTGGACAACAACCGGATCGTGTCGACCTC
GCCCACGGCCACGTTCCACTCCCCTCCCTCCAGCTTCGGCGGCTATGTGCCGGGCAGCTTCGGTGCGGGCGCAGGGTCAC
CAGCGACCACCGGCGGCGTGGTGAAGCCTCTCAAGCCGTTTAACACGACGGACATCAAGATTTTGCTGCTCGAGAACGTC
AACGAGAGCGGACGTGACATCCTGGTGCAGCAGGGATACCAGGTGGAGCACCTCAAGACGTCTCTGTCCGAGGATGAGCT
GATTGCCAAGATCCGCGATGTGCATGTCATCGGCATCCGCTCCAAGACGCGGCTTACGGAGAAGGTGTTGCGGGAGGCCA
AGCATCTGCTCGTTGTCGGCTGCTTCTGCATCGGCACCAACCAAGTCGACCTCGACTATGCCGCCCGCAACGGCATCGCC
GTCTTTAACTCGCCCTTTGCCAACTCGCGCTCCGTGGCCGAGCTGATGATCGGCTGGATCATCATCCTGGCGCGCCAGCT
GAGCGACCGCTCTTCCGAAATGCACCGCGGCACCTGGAACAAGGTGAGCAGTCGCTGCTGGGAGATCCGCGGCAAGACCC
TGGGCATTGTCGGCTACGGCCACATCGGCTCGCAGCTGTCCGTCTTGGCCGAGTCTATGGGCATGTCCGTCATCTACTAC
GACATCGTCACCCTGATGGCCCTTGGCAAGGCCCGCCAGGTGCCCACTCTCGCCGACCTGCTTGGCGAGGCCGACTTTGT
CACCCTGCACGTGCCTGCGACCGCGGATACCCGCAACATGATCGGGCCCGCCCAGCTGGCCCAGATGAAGAAGGGCGCCT
ACCTGCTCAACGCCAGCCGCGGCACCGTTGTCGACATTCCCGCCCTCGTCGAGGCCCTGCGCTCTGGCAAGCTAGCCGGC
GCCGGCTTAGACGTCTACCCCCAGGAGCCCGCCGCCAACGGCGACTACTTTAACGGCAAGCTGAACCCCGACTTTGGTGA
CCAGCTGCGCGGACTCAAGAACGTCATCTTGACGCCGCACATTGGCGGCAGCACGGAGGAGGCCCAGCGGGCGATCGGTG
TCGAAGGTGAGAGACATTCAGAGACTGTGTGGTTTGGTGCCTGTGTCGAGAACTACGCTAACTTTCCTTGCAGTCGGCGA
TGCTCTTGTGCGGTACATCAACCAGGGCGTCACCCTCGGCAGCGTCAACCTGCCGGAGGTGAACATGCGCTCGCTGACGC
TCGACGAGCCAAACCACGCCCGGGTATGTCTGACGACTGACGTCCTATATCGACAGGTTTGCCTGTGCTAACTACCCCCT
TCTCCTTAGGTTATCTACGTCCATCGCAACGTGCCGGGTGTTTTGCGCCGTGTCAACGAAATTCTAGGCAACCACAACGT
CGACAAGCAGATCACCGACAGCAAGGGCGATGTAAGTCTTTTCAGCTCAACTACGTTACCTCGGCCCTTGTATTAGTGGT
GCTAACCATACTCTCATCAGACCGCATACCTGATGGCCGACATCAGTGACGTCAAGCCCAGCGACCTAAAGGAGATCACC
GACAATCTGGAAGCTCTCAGCTGTAAGTCGACCCCCAAAACGCGCTATGAGGTTGGGCAGAGTACTAACGCAACGAAGCC
CGCATCTTGACGCGGGTGCTTTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62