GenePrediction:GLEAN_4672 Details

Name: GLEAN_4672
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1108060..1103016 (- strand)
Length: 5045
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1108060..1107926 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1107858..1107726 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_167:1107647..1103635 (- strand)
Length: 4013
Type: CDS
Source: GLEAN
Position: GCSC_167:1103574..1103501 (- strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_167:1103438..1103224 (- strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_167:1103161..1103016 (- strand)
Length: 146
>GLEAN_4672 class=GenePrediction position=GCSC_167:1108060..1103016 (- strand)
ATGGCGGAGACTTACGATGTTGGAACACGGGCATGGCAACCTGATGTCACAGAGGGCTGGGTGCCCTCCGAGGTCATCAA
GAAGGATGTGCAGGGCAACAAGGTCGTCCTGGAGTTCAGGCTCGACAATGGCGAGGTAAGCTTGGGAACAGTTTCCCGGT
GGAATAACATGGGGAGACTTGTACTGACAGACGTGGTCTCAGACGAAAAGGATTGAGGTCACTGCAGAGGCTCTCCATAA
AGGCAGTGACCCCTCTCTTCCGCCGCTGATGAACCCGGCTATGCTCGAGGCCAGCGACGACTTGACAAACCTATCACATT
TGAACGAGCCTGCTGGTATGTTGTGATGCATAGGAATGCTCTTGGCCTCTTTCCTTGTCACATCCCGCTAACTGATCACC
CTGTGCTCTCCAGTCCTGCAAGCCATCAGACTCCGATATGCCCAAAAGGAGATCTACACATACTCTGGAATCGTCTTAAT
AGCAACGAACCCTTTCGCACGTGTCGACTCCCTCTATGTACCGGGCATGGTACAGGTCTATGCCGGCAAGCAGCGCGCAA
CCCAGGCACCACATTTGTTTGCCATTGCCGAGGAGGCCTTTATGGACATGATCCGGGATAACAAGAACCAGACCGTCGTC
GTCTCCGGTGAGTCTGGTGCCGGAAAGACCGTGAGCGCCAAATATATCATGCGCTACTTTGCAACTCGCGAATCGCCCAA
AAACCCGGGCTCTCGCTCGAAGAAGTCGGAGGCCATGAGCGAGACCGAAGAACAGATCCTGGCAACCAATCCGATTATGG
AAGCTTTTGGTAACGCCAAGACCACCCGAAACGACAACTCGTCCCGTTTCGGTAAATACATTGAAATCTTGTTTGACGAC
AATACCAACATCATCGGTGCCAAGATCCGCACATACCTGCTAGAACGGTCGCGTCTCGTCTTCCAGCCCCTCAAGGAGCG
CAACTACCATATCTTCTACCAGATGGTGGCTGGTATTTCAGAGCAGGAGCGGAAGGAGCTAGACATTCTCCCAGTCGAGC
AGTTTGAATACCTCAACCAAGGCAACACCCCAATTATTGACGGTGTCGACGATAAGGCCGAGTTCTTTGCTACCAAGGCC
TCTCTCAAGACCATCGGTATAAATGAGGAACAGCAAGACGGCATTTTCAAGCTTCTGGCCGGTCTGTTGCATCTCGGCAA
CGTCAAGATCGGTCAGACCAGAACTGAGGCCGTCCTGGCAGCCGACGAACCGTCGCTGGAGCGTGCTTGTTCGATCCTCG
GTATTGATGCGCCTGAGTTTGCTCGCTGGATTGTCAAGAAGCAGCTTGTTACGCGTGGTGACAAGATCATCTCCAACTTG
TCCACAGCCCAGGCTTTTGTTGTGCGAGACTCGGTTGCCAAGTTTATCTACTCAAGCATGTTTGACTGGCTTGTTGAGGT
AATCAACAACAGTCTGGCCACCGAAGAGGTGCTAAACCGCGTGCATTCCTTCATTGGTGTGCTCGATATCTACGGCTTTG
AGCATTTTGCAAAAAACTCCTTCGAGCAGTTTTGTATCAACTACGCAAACGAGAAGCTGCAGCAGGAGTTCAACCAGCAT
GTCTTCAAGCTCGAGCAGGAAGAATATCTGCGGGAAAAGATTGACTGGACTTTCATTGACTTCTCGGACAACCAGCCCTG
TATTGATTTGATTGAGGGTCGCATGGGTATTTTGTCTCTGCTGGACGAAGAGTCTCGACTGCCCATGGGTTCCGATGAGC
AACTTGTTCTGAAGCTGCACCAGAACTTCGCACCTGACAAGAACAAGTTCTACAAGAAGCCTCGGTTTGGGAAGTCATCC
TTCACCGTCTGTCATTACGCCATTGACGTTACATACGAGTCCGATGGATTCATCGACAAGAACCGCGATACTGTTCCCGA
CGAGCATCTTGCCGTCCTGCGGGCCTCCACTAACGACTTCCTCCGCTTTGTGCTAGATGCTGCCTCTGCAGTGCGCGAGA
AGGATCTTGCTTCGGCTACGACGGCGGTCAAGCCGACTGCCGGCCGTCGCATAGGTGTCGCTGTTAACCGCAAGCCGACT
CTTGGCGGTATATTCCGAACCTCGCTGATTGAGCTCATGAGCACCATCAACAACACTGACGTGCACTATATCCGCTGTAT
TAAGCCCAACGAGGCCAAGGAGGCTTGGATGTTCGAGGGACCCATGGTGCTGAGCCAGCTGCGGGCTTGTGGTGTGCTCG
AGACCGTCCGTATCAGCACTGCCGGTTACCCGACTCGATGGACGTACGAAGAGTTTGCTTTGCGGTACTACATGCTCGTG
CACTCGTCCCAGTGGACGTCAGAGATCCGCCAGATGGCCGACGCCATCCTCACAAAGGCTCTCGGTGCAAAAACTGGAAA
GGGTGTTGACAAGTACCAGCTGGGTCTAACCAAGATCTTCTTCCGCGCCGGTATGCTGGCGTTCCTCGAGAACCTGCGGA
CTACGCGGCTCAACGCTTGTGCCGTGATGATCCAGAAGAACCTACGCGCCAAATACTATCGCCACCGTTACCTGGCCGCT
CGGGAGGCTATCATCCGACTCCAGGCAGTTGCTCGTGCGTACTCTTCAAGGCAGCATGCCCAGGAACTGCGCACCGTTAA
TGCTGCTACTACGATTCAGCGTGTGTGGCGCGGTCAGAAGCAGCGCCGGGAGTTCTTGCGCATTCGTGCCGACGTTGTCC
TTGCCCAGGCGGCCTTCAAGGGCTACCTACGGCGCAAGGAGATCATGGAGACACGACTAGGCAACGCAGCCCTGCTTCTC
CAACGCCTGTGGCGCTCGCGCGCGGCAAAGCGCACCTGGAACTCGTATCGCAAAAAGGTTGTTCTTATTCAGAGTGTGTG
GCGCGGTCTGACCGCACGCCGTGGCTACAAGACGATGCGCGAGGAGGCACGCGATCTGAAGCAGATTTCGTACAAGCTGG
AGAACAAGGTCGTCGAGCTAACACAGTCATTGGGCACAATCAAGGCACAGAACAAGGAGCTCAAGACCCAGGTGGAGAGC
TACCAGGGTCAAATCAAGTCGTGGCAGACACGCCACAAGGACCTCGAGCAGAAGACAAAGGAGCTGCAGACAGAGGCCAA
CCAGGCCGGTATTACGGCGGCACGCCTGGCACAGATGGAGGACGAGATGAAGAAGCTACAGCACAGCTTCGAGGAGTCAA
CGGCGAATGTCAAGCGGATGCAGAAGGAGGAGCAGGATCTGAAAGATTCCCTGCGGGCAACGAGTGCCCAGCTGGAGACT
GCCCGACAAGATGTGACACGGTCCGAGGCAGAGAAGAACAACCTGCGCCAGCAGCTCGTCGACATGCAGGATGCTCTCGA
CGAGGCGCGCCGTTCTGCTCCTTTGATCGGCGGTGCGGGCGACCTGGCCAACGGAGCCAACGGCGTCAACGGCATTGCCA
ACGGACTAATCAACCTGGTGGCCTCCAAGAAGCCGTCCAAGCGTCGCAGCGCCGGCGCAGAGCCACTTGACCGGTACAGC
ATGGCCTACAACCCACGGCCGGTGTCGATGGCGGTGGCGGGTCGGCAGGTTCTTCCTGGCGTGGACAACGTGGAGCTGGA
GCTCGAGAGCCTGCTGGCGGACGAGGACTCTCTCAACGACGAGGTGACGCTGGGCCTGATCCGCAACCTGAAGATCCCGT
CGCCGAACTCGACGCCGCCGCCGTCGGACAAGGAGGTGCTCTTCCCGTCGTACCTGATCAACCTGGTAACGTCGGAGATG
TGGAACAACGGGTTCGTCAAGGAGTCGGAGCGGTTCCTGGCCAACGTGATGCAGTCGGTCCAGCAGGAGGTGATGCAGCA
CGAGGGCGAGGATGCGATCAACCCTGGGGCGTTCTGGCTGTCCAACGTGCACGAGATGCTCTCGTTTGTGTTCCTGGCGG
AAGACTGGTATGAACAGCAAAAGACGGACAACTACGAGTATGACCGTCTCCTGGAGATTGTCAAGCACGATCTTGAAAGC
CTCGAGTTCAACATCTACCACACGTGGATGAAGGTGCTGAAGAAGAAGCTGCAGAAGATGATCATCCCGGCGATCATCGA
GTCGCAGTCGCTTCCTGGCTTCGTTACGAACGAGAACAACCGGTTCCTGGGCAAGCTGCTGCAGTCCAACAGCACGCCGG
CCTACAGCATGGACAACCTGCTTAGCCTGCTGAACAGCGTGTACCGTGCGATGAAGGCCTACTATCTGGAGGACTCGATC
ATCACCCAGACGGTGACGGAGCTGCTGCGCCTGGTCGGCGTGACTGCCTTCAACGACCTGTTGATGCGCCGCAACTTCCT
GTCATGGAAGCGTGGCCTGCAAATCAACTACAACATCACCCGTATCGAGGAGTGGTGCAAGAGCCACGATATGCCGGAGG
GCACGCTCCAGCTGGAGCACCTGATGGTAAGCTTCGACGTTCTCGTCTGGAGATGCCGAGTATGTGCTAACTTAACTATC
TCACAGCAAGCGACCAAGCTGCTGCAGCTGAAGAAGGCGACGCTGAACGATATCGAGATTATCCAGGATATCTGTTGGAT
GTGAGTTGTCCCGTGACCAATTGCAGACGTGCAACAACAGTGAACTGACGGGCAACAACTAGGCTCTCGCCCAACCAGAT
CCAGAAGCTGCTAAACCAGTATCTAGTGGCAGACTACGAGCAGCCCATCAACGGCGAGATCATGAAGGCGGTTGCCTCCA
AGGTCAACGAGAAGGGCGACGTGTTGCTGCTACAAGCTGTCGATATGGATGACAGCGGGCCATACGAGATTGCCGAACCG
CGTGTGATCACAGCCCTGGAGACGTACACACCGTCTTGTAAGTGGTCATGCTCGCCGTCGGATCCCGTTTGTGCAGACAG
GCTAACAGATGTTTCGCAGGGCTCCAAACGCCGAGACTCAAGCGGTTGGCAGAAATCGTTTCGGCGCAAGCAATTGCGCA
GCAAGAAAAGCAGGAGCTAGACTACGAGCAGGCGGAGCTGACAGAGATGGACGAAGAGGTCAAGGCCATTGAGGCCAGCG
CCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62